Busch Lab

ZMP

si:ch211-59c24.3

Ensembl ID:
ENSDARG00000095496
ZFIN ID:
ZDB-GENE-060503-701
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1MTA3]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa16748 Nonsense Available for shipment Available now
sa36584 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44883 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa16748
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133555 None None 129 None 5
ENSDART00000147613 Nonsense 328 1017 5 12

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 10337209)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 10920455
GRCz11 18 10889173
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGTTGAAGAGTGCAGAGATTAGAAAAAGTTTAGGGCTYACTCCCCTGGAA[C/T]GAAGCAAAACTGYGGTGGAGAAGAGCATTGTGAAAACKCCAACACCCGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36584
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133555 None None 129 None 5
ENSDART00000147613 Essential Splice Site 783 1017 None 12

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 10338576)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 10921822
GRCz11 18 10890540
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGGAGACTCGGGGAAGAAGAAAGATTCACCCCTGGACAGGTCCTCAGG[T/C]CAGCTGGAAGTTTTTCATTTGAATGGCTCATCTTTTTTTCTAGCAGTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44883
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133555 Nonsense 88 129 5 5
ENSDART00000147613 Nonsense 976 1017 12 12

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 10369292)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 10952538
GRCz11 18 10921256
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAGACAGAGGAGGAGCTGGCAGAGGAGAAGCAGATTCTGAATGAGATGT[T/A]GGAGGTGGTGGAGCAGCGAGACTCTCTGGTGGCCCTGCTGGAGGAACAGA
Associated Phenotype:
Not determined