Busch Lab

ZMP

si:dkey-14p11.4

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa11769 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11769
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133930 Nonsense 137 181 3 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 9522633)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9480774
GRCz11 23 9415744
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTTTCTCTCCAGCTGACAGAGCAGGTTCATGAGCTGCACGCTCTGCTGT[C/A]GGAGGYGAGAGAGAAGGCTCATGGAGCACAAGAAGCTCTGTCACAGGAGA
Associated Phenotype:
Not determined