Busch Lab

ZMP

si:dkey-14p11.5

Ensembl ID:
ENSDARG00000063075
ZFIN ID:
ZDB-GENE-090313-188
Human Orthologue:
C20orf117
Human Description:
chromosome 20 open reading frame 117 [Source:HGNC Symbol;Acc:16111]
Mouse Orthologue:
9830001H06Rik
Mouse Description:
RIKEN cDNA 9830001H06 gene Gene [Source:MGI Symbol;Acc:MGI:2444575]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa15992 Nonsense Available for shipment Available now
sa8520 Nonsense Mutation detected in F1 DNA Not yet available
sa37624 Nonsense Available for shipment Available now
sa5028 Nonsense F2 line generated Not yet available
sa11769 Nonsense Available for shipment Available now
sa11466 Nonsense Available for shipment Available now
sa8553 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa37623 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa15992
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091852 Nonsense 68 1793 1 14
ENSDART00000139688 None None 339 None 3
Genomic Location (Zv9):
Chromosome 23 (position 9598464)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9556605
GRCz11 23 9491575
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGCTACAAGTTACCGAGAAAAAGAAAATACACCGGGCACCGTCTCCTGCA[C/T]GACCCAAAGATGTGGCCGGCTGGTCACTCACTAAAATCCGCGGCGGTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8520
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091852 Nonsense 534 1793 5 14
ENSDART00000139688 None None 339 None 3
Genomic Location (Zv9):
Chromosome 23 (position 9530034)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9488175
GRCz11 23 9423145
KASP Assay ID:
2261-7355.1 (used for ordering genotyping assays)
KASP Sequence:
GAAACTAGTGGAGGAGGAAGCGAATCTTCTAAGTCGAYGGATTGTAGAGT[T/A]GGAGKTKGAAAACCGTGGCCTTCGTGCTGAAATGGACGACATGAAGATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37624
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091852 Nonsense 596 1793 5 14
ENSDART00000139688 None None 339 None 3
Genomic Location (Zv9):
Chromosome 23 (position 9529848)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9487989
GRCz11 23 9422959
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCGACACCTACAGTTTGTGGAAGAAGAGGCAGATCTGCTTCGTAGGTCCT[T/A]GATCGAAATGGAGGAGCAGAACAAGCTCTTGATGAACGAGCTTAACCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5028
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091852 Nonsense 784 1793 5 14
ENSDART00000139688 None None 339 None 3
Genomic Location (Zv9):
Chromosome 23 (position 9529283)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9487424
GRCz11 23 9422394
KASP Assay ID:
554-3573.1 (used for ordering genotyping assays)
KASP Sequence:
CAGCTTCTGACTTCACCCGACACCTCCTGTATCTCACCGGACTCTGTCTA[T/G]CGCAAGATCACCGCCAATGATTCTGCTGAACCGGTTCTACTAGAGAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11769
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091852 Nonsense 935 1793 7 14
ENSDART00000139688 None None 339 None 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 9522633)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9480774
GRCz11 23 9415744
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTTTCTCTCCAGCTGACAGAGCAGGTTCATGAGCTGCACGCTCTGCTGT[C/A]GGAGGYGAGAGAGAAGGCTCATGGAGCACAAGAAGCTCTGTCACAGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11466
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091852 Nonsense 1204 1793 11 14
ENSDART00000139688 None None 339 None 3
Genomic Location (Zv9):
Chromosome 23 (position 9512532)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9470673
GRCz11 23 9405643
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGTKATGGACCTTACCAAACAACTGCAGATCAGTGAGAAAAACTGGAGC[C/T]GAGAGCGGCKAGAGCTTCTGGAGCACTTCAACCAGGAAAGAAGTCAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8553
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091852 Essential Splice Site 1257 1793 13 14
ENSDART00000139688 None None 339 None 3
Genomic Location (Zv9):
Chromosome 23 (position 9510255)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9468396
GRCz11 23 9403366
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
MCATTTAATCAGGCATTATTATTTTRTAATCTTTTCCAATCTCTTACWAC[A/T]GGACCAAATCAATATCCMCCCTCACTGAGTTGAAGAGTCTGCTAGACACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37623
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091852 Nonsense 1470 1793 13 14
ENSDART00000139688 None None 339 None 3
Genomic Location (Zv9):
Chromosome 23 (position 9509616)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9467757
GRCz11 23 9402727
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATTTCAGGCAACCTTAGCGATGACATGAAGGAGATGACCAATTGTGTA[C/T]GACAGGCCATTCGTTCCAGTTCCCTGGAAAGGAAATGCAGCAAAGATACA
Associated Phenotype:
Not determined