Busch Lab

ZMP

si:dkey-19f23.4

Ensembl ID:
ENSDARG00000094178
ZFIN ID:
ZDB-GENE-091204-435
Human Orthologue:
SBNO2
Human Description:
strawberry notch homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:29158]
Mouse Orthologue:
Sbno2
Mouse Description:
strawberry notch homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2448490]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa37491 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37491
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000141844 Essential Splice Site 104 402 None 9

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 17935153)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17686088
GRCz11 22 17711066
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGCATCATTCTAGAAAACAACTTAAAGGGAAGGAAAAAAGCACTATGG[T/A]GAGAAGCATCGACATCCAGCACAACTGACCGACTTTACTGGCACACTCAT
Associated Phenotype:
Not determined