Busch Lab

ZMP

si:ch73-63e15.2

Ensembl ID:
ENSDARG00000016188
ZFIN ID:
ZDB-GENE-091204-463
Human Orthologue:
SBNO2
Human Description:
strawberry notch homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:29158]
Mouse Orthologue:
Sbno2
Mouse Description:
strawberry notch homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2448490]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa37491 Essential Splice Site Available for shipment Available now
sa37490 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37491
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056032 Essential Splice Site 300 1452 None 31
ENSDART00000137984 None None 729 None 13

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 17935153)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17686088
GRCz11 22 17711066
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGCATCATTCTAGAAAACAACTTAAAGGGAAGGAAAAAAGCACTATGG[T/A]GAGAAGCATCGACATCCAGCACAACTGACCGACTTTACTGGCACACTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37490
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056032 Nonsense 855 1452 22 31
ENSDART00000137984 Nonsense 132 729 4 13
Genomic Location (Zv9):
Chromosome 22 (position 17921989)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17672924
GRCz11 22 17697902
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACAAGTTCTTTGGTGCTGACTTTTCATTTGCATTTTAATAGGGAGCTT[T/A]GACTCATGGTGACAGGAGAGCCACAGAGTCTAGAGACCTGAGCAAATACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30549
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056032 Essential Splice Site 876 1452 22 31
ENSDART00000137984 Essential Splice Site 153 729 4 13
Genomic Location (Zv9):
Chromosome 22 (position 17921924)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17672859
GRCz11 22 17697837
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGAGCCACAGAGTCTAGAGACCTGAGCAAATACAACTTTGAAAATAAA[G/A]TAAGTAACTGTTTCACATAACACAGAGTAAAACACATGTCATTGACTAAC
Associated Phenotype:
Not determined