Busch Lab

ZMP

irak1

Ensembl ID:
ENSDARG00000093174
ZFIN ID:
ZDB-GENE-071116-5
Description:
Novel protein similar to vertebrate interleukin-1 receptor-associated kinase 1 (IRAK1) [Source:UniPr

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa15573 Essential Splice Site Available for shipment Available now
sa41119 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa15573
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133612 Essential Splice Site 38 96 None 2
ENSDART00000138859 None None 56 None 5

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 8140035)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7584672
GRCz11 8 7603403
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCACTCGGGTTATGGACTCRCTTTCAAACTCAGACKGGATATCWTTCGG[T/C]AAGATTCATGGCKTTGTGTTTGTTTTTGTATCACAATKGTGCTGTGTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41119
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133612 Nonsense 80 96 2 2
ENSDART00000138859 None None 56 None 5

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 8132605)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7577242
GRCz11 8 7595973
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAATTGGGGTTGTCGCAATGGGACAGTTGGAGCACTGCTGAAGATTCTT[G/T]AGGGACTCCAGTGGTTCAGAGCTCGTGATATCATTCTCAAAGCACAACTA
Associated Phenotype:
Not determined