Busch Lab

ZMP

B8JKB7_DANRE

Ensembl ID:
ENSDARG00000092430
Description:
Novel protein similar to H.sapiens MYO1B, myosin IB (MYO1B) [Source:UniProtKB/TrEMBL;Acc:B8JKB7]
Human Orthologue:
MYO1B
Human Description:
myosin IB [Source:HGNC Symbol;Acc:7596]
Mouse Orthologue:
Myo1b
Mouse Description:
myosin IB Gene [Source:MGI Symbol;Acc:MGI:107752]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa14798 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5530
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077186 Splice Site, Nonsense 42 166 1 6
ENSDART00000131398 Splice Site, Nonsense 101 225 2 7
ENSDART00000134797 Splice Site, Nonsense 103 313 2 9
Genomic Location (Zv9):
Chromosome 9 (position 16362925)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 16280706
GRCz11 9 16217972
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGTCATTCATTGAGAATCTAAAAAAGCGATTCGATCACAATGAGATCTA[T/A]GTAAGTATTTGCTTAAAATCAATTTATCTTTATTTGGATGTGTTCTTATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27369
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077186 Nonsense 75 166 2 6
ENSDART00000131398 Nonsense 134 225 3 7
ENSDART00000134797 Nonsense 136 313 3 9
Genomic Location (Zv9):
Chromosome 9 (position 16366392)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 16277239
GRCz11 9 16214505
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCATTTACTCAGCAGAAAAGGTGGAGGAGTATCGCAACAGAAACTTCTA[T/A]GAGCTCAGTCCACACATGTGAGTTTTGAATCAATGTTTTATATATATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14798
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077186 None None 166 None 6
ENSDART00000131398 None None 225 None 7
ENSDART00000134797 Essential Splice Site 279 313 None 9

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 16411507)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 16232145
GRCz11 9 16169411
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTACCCYTGTCTTAYTGTTACTGTTAAACTCTAMTTGTAATTGTATTTC[A/T]GAAAAACTGAAGCTGGACCGGGACTTCAGCAAATATAACTACCTTAGCCT
Associated Phenotype:
Not determined