Busch Lab

ZMP

si:dkey-25e12.6

Ensembl ID:
ENSDARG00000091891
ZFIN ID:
ZDB-GENE-041001-134
Description:
Novel protein similar to methylenetetrahydrofolate dehydrogenase (NADP+ dependent), methenyltetrahyd
Human Orthologues:
AL445665.1, MTHFD2, MTHFD2L
Human Descriptions:
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like [Source:HGNC Symbol;Acc:31865]
Mouse Orthologues:
Mthfd2, Mthfd2l
Mouse Descriptions:
methylenetetrahydrofolate dehydrogenase (NAD+ dependent), methenyltetrahydrofolate cyclohydrolase Ge
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like Gene [Source:MGI Symbol;Acc:MGI:191

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa17397 Essential Splice Site Available for shipment Available now
sa44942 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa915 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4904
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000147154 Essential Splice Site 6 122 None 5
ENSDART00000147154 Essential Splice Site 6 122 None 5

The following transcripts of ENSDARG00000091891 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 26521155)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26592458
GRCz11 20 26491548
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAAGTTGCTGCTCAGGGAAGCCGTTTTCAGTTCCTGTATAACTTGCAGG[T/C]GAGAACAGACGCAAGTAGTTACAGTGTAGAAGAAAACAAACAAAATGATC
Long Flanking Sequence:
ATGTTCATGACAGATTTATGACAAGTTATGTTGCATTGGTTATGTTAAATTGTCATGACAAGGACATCTCAAACAGCATCTTGGATTTTAAATGACAACTTAGCGAATAAGCATGCATAAAATCTCCTTCATGTTCATGACGTGTCATGTCATAATTATTAAGGTGTCGTAATGGTCTTATGAACATCCCCTTCAAGTTAAGTGTTACCCATCTGTCTTTCTAGCATGCTTTAATTTTTTTCTCAAAATTTTTGATTAATATCCATGTTTAGCCAGAGTGTTGTCTGCCCTGTGCCCAAGTATGTTTTTCTTTAAATCAAGGACAGACACTCAAGCAGAGATTGACCTGGTTTGTCGCATTGCAAAGGCTTCTGGGGCGTCCGCTGCAGTGCCATGTCATCATTGGTCCAGAGGTGGACGGGGCTCTCTTGAACTGGCACACGCTGTAAAGGAAGTTGCTGCTCAGGGAAGCCGTTTTCAGTTCCTGTATAACTTGCAGG[T/C]GAGAACAGACGCAAGTAGTTACAGTGTAGAAGAAAACAAACAAAATGATCTCGTGTAAACCAAATTTAATCTAAGACCAGGCCAGGCAGACTCAGAGTGATGAATTAAACATGATTGTATCTGAAAGGGAGTCTTCTATAATGTGCTAATGGTTTTTTCCCTCCAGTCTGAGCATGTCAGGTTTAAGGAGGGTCTGTGGAGGCATCAGCTGGTTTGAGTTAACCTTAGTGAGTTTGGAGGTTGTGACATTGATTAAACAATGCTATGAAAGGAGCTGTAATCTCTGCCCTTGGCTCTGGCTGGTCTCTATTATCCTATTAGAGGTCTGAACACTTGCTATCCCAATCATCTGCCCAGAGAAATGACTGGGGTGATTTTATGGCCATCAGATTGGCGGAAGCTTCAATTCAGAACTGATAATGAGGTTAAAGTGTTTTTAAATTCTTCCCGCTTTTATCTGCATGCCTTTTATTTCAAGGAATTAGCGTGTCCTGTGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17397
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000147154 Essential Splice Site 6 122 None 5
ENSDART00000147154 Essential Splice Site 6 122 None 5

The following transcripts of ENSDARG00000091891 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 26521155)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26592458
GRCz11 20 26491548
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAAGTTGCTGCTCAGGGAAGCCGTTTTCAGTTCCTGTATAACTTGCAGG[T/C]GAGAACAGACGCAAGTAGTTACAGTGTAGAAGAAAACAAACAAAATGATC
Long Flanking Sequence:
ATGTTCATGACAGATTTATGACAAGTTATGTTGCATTGGTTATGTTAAATTGTCATGACAAGGACATCTCAAACAGCATCTTGGATTTTAAATGACAACTTAGCGAATAAGCATGCATAAAATCTCCTTCATGTTCATGACGTGTCATGTCATAATTATTAAGGTGTCGTAATGGTCTTATGAACATCCCCTTCAAGTTAAGTGTTACCCATCTGTCTTTCTAGCATGCTTTAATTTTTTTCTCAAAATTTTTGATTAATATCCATGTTTAGCCAGAGTGTTGTCTGCCCTGTGCCCAAGTATGTTTTTCTTTAAATCAAGGACAGACACTCAAGCAGAGATTGACCTGGTTTGTCGCATTGCAAAGGCTTCTGGGGCGTCCGCTGCAGTGCCATGTCATCATTGGTCCAGAGGTGGACGGGGCTCTCTTGAACTGGCACACGCTGTAAAGGAAGTTGCTGCTCAGGGAAGCCGTTTTCAGTTCCTGTATAACTTGCAGG[T/C]GAGAACAGACGCAAGTAGTTACAGTGTAGAAGAAAACAAACAAAATGATCTCGTGTAAACCAAATTTAATCTAAGACCAGGCCAGGCAGACTCAGAGTGATGAATTAAACATGATTGTATCTGAAAGGGAGTCTTCTATAATGTGCTAATGGTTTTTTCCCTCCAGTCTGAGCATGTCAGGTTTAAGGAGGGTCTGTGGAGGCATCAGCTGGTTTGAGTTAACCTTAGTGAGTTTGGAGGTTGTGACATTGATTAAACAATGCTATGAAAGGAGCTGTAATCTCTGCCCTTGGCTCTGGCTGGTCTCTATTATCCTATTAGAGGTCTGAACACTTGCTATCCCAATCATCTGCCCAGAGAAATGACTGGGGTGATTTTATGGCCATCAGATTGGCGGAAGCTTCAATTCAGAACTGATAATGAGGTTAAAGTGTTTTTAAATTCTTCCCGCTTTTATCTGCATGCCTTTTATTTCAAGGAATTAGCGTGTCCTGTGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44942
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000147154 Essential Splice Site 93 122 None 5

The following transcripts of ENSDARG00000091891 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 26518392)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26589695
GRCz11 20 26488785
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTCCGTGCCAGCATCGGCGCAGGCTTTATCTACCCTTTAGTTGGAACAG[T/C]AAGTGATTATTCTCGAAATCTGATGAAAGCTCTCGTCTTGGTCCATTCTT
Long Flanking Sequence:
TAGCCACTATCTGCAATTACATATTTAGTCACAATAGGCAACGCTTGGACTTATTTCTGAAAAAAAATCTAATAATAAAAATATTGAAATAAAAAAAAGTCAGATTTCATATTGCAGCGTAACAATTCCAATGTTCAAGCATGAAAAACTGGCATAATAGCAAATGTTTCTTAACCTGTTTACTTACTGATATGAAATAGTTAAATAATCTTGGCCCAACCGGTTGGAATTGTGTTCAGTGAAGCAGTGCATCTCAAAACATTACAGTTAACGGGTATCAATAGCCCAGAGCCGATGATATGCATGTCTCATATGGGTATTAACATTGTCTATAAATCTCTCACAGGGCTTTGGTGCTCTTCCTATCTGCATGGCCAAAACCCACCTGTCTCTCTCTCACATGCCTGAGAAAAAAGGTGTTCCCACCAACTTTATCCTGCCCATCAGAGACGTCCGTGCCAGCATCGGCGCAGGCTTTATCTACCCTTTAGTTGGAACAG[T/C]AAGTGATTATTCTCGAAATCTGATGAAAGCTCTCGTCTTGGTCCATTCTTTTCAGTTCTATCTGCATGTCCACACTTTCATATTTAATGGTTTTCACTCATTCAATGCCATCCACTCTACACATTACCTTTTTTATTATTACTTCCTCTACTGCTAAGTAAGTATATGTTTCAGTTACTAATAGGATCCAGGATTACGGTTGAACCTGTGATCTATGACCTCTGAGGGTTTTTTAAAAAAAGCATTCAGGCCAAATTCCTCTGCCTTCATGTTTTTGCTCTCTTAAAAAACAATATTGCCTGGCCTTAGGCAGATATATCTCTTCTCTAAATTCCTGACAATGTTTGGTTAAGGCAGTTTTCATTAATGAGAGGTCTATTGGATTCTCGGTTCCAATTCATGGTAAAACCTGTTGAGACAGTTTGATTAAGCCTTGTGAAAACAGATTTTAGAGAATGTGCGGTCAACTTTTGAATGACCCATGCTTGTGTATGTGTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa915
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000147154 Nonsense 103 122 4 5

The following transcripts of ENSDARG00000091891 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 26510614)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26581917
GRCz11 20 26481007
KASP Assay ID:
554-0821.1 (used for ordering genotyping assays)
KASP Sequence:
TCTTCTTTTCTCTTGTCTTTCAGATGAGCACTATGCCAGGCTTGCCTACA[C/T]GACCCTGTTTCTATGACATTGACCTTGATCCTGTGACCGAGGAGATAAAA
Long Flanking Sequence:
GGGAAAACATAATGAATGCAGACTGCCTTAATGACAGATCATCTTACACCGTTGTATTTTAAAAATAAAACATTCGTTTTAAGAAAGAGCACTCATTGGATGATTTGGGTTTGGCTTTTCTGGCTCCAGCGTTAATTTCTGTTTACAGTTTAGATTTGTCTGACAGTGAAGTCCTTTGGTTTTAACAAGATTTGCCTAGAAAAGACATTTTGCAAGAAAATTTCTTCAACATACTTCAGCATCTTTGAAACAACTTCTTGTTTTAGACTGAATTTATGATCCTTCCTACTAAGTGAATCTAAACCTGAGTTCCCTTGTGACTCCATTACACTGTTTCCTCTGATGTTTTGTGGGCATACAATATATTTGCCTTTTTGTTTTGATACCTGTGTCAAATAAAACTGAGCACTGATTCTGTTTTGTGCTATGTATACACTTTAGGTACTCCCTTCTTCTTTTCTCTTGTCTTTCAGATGAGCACTATGCCAGGCTTGCCTACA[C/T]GACCCTGTTTCTATGACATTGACCTTGATCCTGTGACCGAGGAGATAAAAGGCCTTTTCTGAGGACACACTCTTCACCAGTGCGAACTCAACTAGGTCTTAATTCACACTGCAAACATTTGTGCTGAGTTACAATGTTTCGATTGGCTTTACTTAGTATTTCGTTAAACTATGTAAAATTTCTAATTCTGTTCTATTGAGTCTGCAGACTGAGGTTGTATTACAAAACATGAAGTTTATATGATTAAAGGAATAGTTCACTTCTAATGACTGGTAACCATTGAGTTCCACTTAAGTTCCAGTTGAGGCTCTCCATTGACTTCCATAGTATTTAGTTTTGATGGCATCAATTTTAAAGACATCTTTTGTGATTAACATTAGAAAGAAACTCATACAAGTTTGAAACAAGTTGGGAGTGAGTACATGAAGTGAACTACTCCTTTAAGGATCACGTATGAGTCAAATTTTTTTTTTCATTTGGTAAAAAAGTGACACATGACA
Associated Phenotype:
Not determined