Busch Lab

ZMP

si:dkey-25e12.5

Ensembl ID:
ENSDARG00000042221
ZFIN IDs:
ZDB-GENE-041001-133, ZDB-GENE-041210-311, ZDB-GENE-041210-311
Description:
Novel protein similar to methylenetetrahydrofolate dehydrogenase (NADP+ dependent), methenyltetrahyd
Human Orthologue:
MTHFD1L
Human Description:
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like [Source:HGNC Symbol;Acc:21055]
Mouse Orthologue:
Mthfd1l
Mouse Description:
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like Gene [Source:MGI Symbol;Acc:MGI:192

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa23717 Essential Splice Site Available for shipment Available now
sa17397 Essential Splice Site Available for shipment Available now
sa44942 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa915 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23717
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061914 Essential Splice Site 263 978 None 28
ENSDART00000131994 None 263 263 None 7
ENSDART00000145433 None None 650 None 19
Genomic Location (Zv9):
Chromosome 20 (position 26554854)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26626157
GRCz11 20 26525247
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGATACTGCAAACCTGCAGGTGGAGCTCAACAAACCTGCAAAAACAGG[T/G]AAGTTGTCTGATAGATGTGGGAGATTTCGATTTAGTTTATATTTATGCGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4904
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061914 Essential Splice Site 862 978 None 28
ENSDART00000131994 None None 263 None 7
ENSDART00000145433 Essential Splice Site 534 650 None 19
ENSDART00000061914 Essential Splice Site 862 978 None 28
ENSDART00000131994 None None 263 None 7
ENSDART00000145433 Essential Splice Site 534 650 None 19

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 26521155)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26592458
GRCz11 20 26491548
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAAGTTGCTGCTCAGGGAAGCCGTTTTCAGTTCCTGTATAACTTGCAGG[T/C]GAGAACAGACGCAAGTAGTTACAGTGTAGAAGAAAACAAACAAAATGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17397
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061914 Essential Splice Site 862 978 None 28
ENSDART00000131994 None None 263 None 7
ENSDART00000145433 Essential Splice Site 534 650 None 19
ENSDART00000061914 Essential Splice Site 862 978 None 28
ENSDART00000131994 None None 263 None 7
ENSDART00000145433 Essential Splice Site 534 650 None 19

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 26521155)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26592458
GRCz11 20 26491548
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAAGTTGCTGCTCAGGGAAGCCGTTTTCAGTTCCTGTATAACTTGCAGG[T/C]GAGAACAGACGCAAGTAGTTACAGTGTAGAAGAAAACAAACAAAATGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44942
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061914 Essential Splice Site 949 978 None 28
ENSDART00000131994 None None 263 None 7
ENSDART00000145433 Essential Splice Site 621 650 None 19

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 26518392)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26589695
GRCz11 20 26488785
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTCCGTGCCAGCATCGGCGCAGGCTTTATCTACCCTTTAGTTGGAACAG[T/C]AAGTGATTATTCTCGAAATCTGATGAAAGCTCTCGTCTTGGTCCATTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa915
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061914 Nonsense 959 978 27 28
ENSDART00000131994 None None 263 None 7
ENSDART00000145433 Nonsense 631 650 18 19

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 26510614)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26581917
GRCz11 20 26481007
KASP Assay ID:
554-0821.1 (used for ordering genotyping assays)
KASP Sequence:
TCTTCTTTTCTCTTGTCTTTCAGATGAGCACTATGCCAGGCTTGCCTACA[C/T]GACCCTGTTTCTATGACATTGACCTTGATCCTGTGACCGAGGAGATAAAA
Associated Phenotype:
Not determined