Busch Lab

ZMP

si:ch73-250d21.1

Ensembl ID:
ENSDARG00000063337
ZFIN ID:
ZDB-GENE-030131-5554
Description:
glutamate receptor interacting protein 2 [Source:RefSeq peptide;Acc:NP_001116760]
Human Orthologue:
GRIP1
Human Description:
glutamate receptor interacting protein 1 [Source:HGNC Symbol;Acc:18708]
Mouse Orthologue:
Grip1
Mouse Description:
glutamate receptor interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1921303]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa21193 Essential Splice Site Available for shipment Available now
sa41117 Nonsense Mutation detected in F1 DNA Not yet available
sa883 Nonsense F2 line generated Not yet available
sa15003 Essential Splice Site Available for shipment Available now
sa21192 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21193
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092426 Essential Splice Site 176 736 None 16

The following transcripts of ENSDARG00000063337 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 7797421)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7184224
GRCz11 8 7227772
KASP Assay ID:
2260-0125.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGCGCCGGCTGCCATCCGCTTTATAGAGCCTGACACACCTGCTGAACGG[T/C]GAGAGCAGAGCGCACCTCATGTGTGCTCAACACACTGTGCAATTTGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41117
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092426 Nonsense 404 736 10 16

The following transcripts of ENSDARG00000063337 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 7786175)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7172978
GRCz11 8 7216526
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTGAAGGGCAAACCTCTGAGCGAAGCCATTCACCTGCTGCAGACCGCT[G/T]GAGACACGGTCACACTCAAGATCAAGAAACGATCCGACCGTAAGAGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa883
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092426 Nonsense 497 736 12 16

The following transcripts of ENSDARG00000063337 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 7783006)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7169809
GRCz11 8 7213357
KASP Assay ID:
554-0790.1 (used for ordering genotyping assays)
KASP Sequence:
GGCGTATATATTCATAGGCCATCAGACTTCACTCTTCATCCCAGCGACTG[G/A]AGACAGACCAATCACAGGAGCCCGCTGATGTCAAGAAGACCCGCCCACCG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3680
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092426 Nonsense 554 736 13 16

The following transcripts of ENSDARG00000063337 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 7780043)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7166846
GRCz11 8 7210394
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCGGCCACAACTACAACAGTACAACAGACGCTCAGGAGAACTATTGGTCA[C/T]AAGCTCTTCAGGACCTGGAGACCTGCGGTCAGTCAGAAATCCTGCGCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15003
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092426 Essential Splice Site 626 736 14 16

The following transcripts of ENSDARG00000063337 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 7776559)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7163362
GRCz11 8 7206910
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CWGAGGACCTRAAGGRGAACAGCCCGTCAGTGCCTCTAGAGCTTCATAAG[G/A]TAATGTTCACCTTCCAGCAGCTGGATTCACGTCTTGAACTCTTGCTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21192
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092426 Nonsense 718 736 16 16

The following transcripts of ENSDARG00000063337 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 7776060)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 7162863
GRCz11 8 7206411
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTGGTCATTAGCAGGAATCCTCTCGCTCAGGCGCACGACTGGCCACCT[A/T]AAGACTGTCAGGACACTTCCCAACAGTCTGCACAAAATCCAAGAAAAGTT
Associated Phenotype:
Not determined