Busch Lab

ZMP

wu:fk48d07

Ensembl ID:
ENSDARG00000018425
ZFIN ID:
ZDB-GENE-030131-6611
Human Orthologue:
DDX6
Human Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 [Source:HGNC Symbol;Acc:2747]
Mouse Orthologue:
Ddx6
Mouse Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:104976]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa22848 Essential Splice Site Available for shipment Available now
sa42727 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa22847 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22848
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114495 Essential Splice Site 59 483 1 23
Genomic Location (Zv9):
Chromosome 16 (position 27937038)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25782725
GRCz11 16 25697757
KASP Assay ID:
2260-9695.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATGCCCCAGAAAGGAAGCAGCATACCCCAAAGCAGTGGCGGTATCAGG[T/G]AATCTTCATGTAAAATATGGACTGAACTTTGTTTCTTTTAACATTGATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42727
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114495 Essential Splice Site 323 483 8 23
Genomic Location (Zv9):
Chromosome 16 (position 27929268)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25774955
GRCz11 16 25689987
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTGACGGAAAGACAGAAAGTGCACTGTCTCAATACACTGTTCTCCAGG[G/A]TAAGCAATTTGTTCTTCTACAGATGATGCCAAAGAAGCTTTGGTATAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22847
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114495 Essential Splice Site None 483 None 23

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 27916505)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25762192
GRCz11 16 25677224
KASP Assay ID:
2260-9694.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTCGGTATTAGTGCACTGTTAATAAGGGCCTGTGTGAATGATGTGTTAC[A/T]GACACAGCAACACAAGTTTGTAAACTGGCAGTGTGATGGAGAGTATCGTG
Associated Phenotype:
Not determined