Busch Lab

ZMP

si:ch211-282j22.3

Ensembl ID:
ENSDARG00000095753
ZFIN ID:
ZDB-GENE-091113-49
Human Orthologue:
EDEM3
Human Description:
ER degradation enhancer, mannosidase alpha-like 3 [Source:HGNC Symbol;Acc:16787]
Mouse Orthologue:
Edem3
Mouse Description:
ER degradation enhancer, mannosidase alpha-like 3 Gene [Source:MGI Symbol;Acc:MGI:1914217]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa23886 Nonsense Available for shipment Available now
sa43598 Nonsense Mutation detected in F1 DNA Not yet available
sa13743 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23886
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000145553 Nonsense 118 789 5 19

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 11981563)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13682737
GRCz11 21 13779466
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCGGTTTGTTGGGTGCACATGTGATGGCTGATGTTTTGAAGCAGCGTGGA[C/T]AGAGAATGCAGTGGTACAGAGATGAACTGTTACACATGGCCAAAGAGCTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1899
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000145553 Nonsense 251 789 8 19

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 11978776)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13679950
GRCz11 21 13776679
KASP Assay ID:
554-1889.1 (used for ordering genotyping assays)
KASP Sequence:
GGTGTTGGTGCTGGAATCGACTCTTATTATGAATACTTGATGAAAGCTTA[T/A]ATTCTTCTTGGGGACAAGGTGTACCTTGAGAGATTCAACACAGTACGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43598
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000145553 Nonsense 347 789 11 19

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 11977360)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13678534
GRCz11 21 13775263
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATAACTGATCCAACAGGCCTTTACCACAGAGTTCAGAGTTCACTGGGGA[C/T]AGCACCCATTGAGACCAGAGTTTGCTGAGAGCACATACTTTCTTTACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13743
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000145553 Nonsense 369 789 12 19

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 11976479)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13677653
GRCz11 21 13774382
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTTAAATACCATTTCTGGCCTTGTTTTCWAGGCTACAGGTGATCCGTA[C/A]KACTTGAAAGTGGGCCAGTCTATAGTGGAGAAGCTGAACGCTCATGCTCG
Associated Phenotype:
Not determined