Busch Lab

ZMP

ENSDARG00000095745

Ensembl ID:
ENSDARG00000095745

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa36533 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa36533
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106229 Essential Splice Site 19 309 1 2
Genomic Location (Zv9):
Chromosome 17 (position 50536556)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 49936643
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATCCAGAACCCTGCAGAATTAAACTGGAAGAGACTGAAGAACAAACAGG[T/C]TGGTGTTTATTGATGATTCTTCATTATTCAGGCTAAAGAACAACAAGGAT
Associated Phenotype:
Not determined