Busch Lab

ZMP

sox11b

Ensembl ID:
ENSDARG00000095743
ZFIN ID:
ZDB-GENE-980526-466
Description:
SRY-box containing gene 11b [Source:RefSeq peptide;Acc:NP_571412]
Human Orthologue:
SOX11
Human Description:
SRY (sex determining region Y)-box 11 [Source:HGNC Symbol;Acc:11191]
Mouse Orthologue:
Sox11
Mouse Description:
SRY-box containing gene 11 Gene [Source:MGI Symbol;Acc:MGI:98359]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa37063 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37063
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000141068 Nonsense 48 368 1 1
Genomic Location (Zv9):
Chromosome 20 (position 30061035)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 30132248
GRCz11 20 30035127
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGTGCCACCGAAACCGGACTGGTGCAAGACAGCCACCGGCCACATCAAA[C/T]GACCCATGAATGCGTTTATGGTATGGTCCAAAATCGAGAGGAGAAAAATC
Associated Phenotype:
Not determined