Busch Lab

ZMP

ENSDARG00000095708

Ensembl ID:
ENSDARG00000095708

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa11718 Nonsense Available for shipment Available now
sa39019 Nonsense Mutation detected in F1 DNA Not yet available
sa6361 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4584
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000137870 Nonsense 61 771 1 3
Genomic Location (Zv9):
Chromosome 15 (position 890733)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 931036
GRCz11 15 891839
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGAAAGAGCATATGAAGATTCATAATGGAGAAAAACTTTACACTTGCCAA[C/T]AGTGTGAAAAAAGTTTCACTTGGAAACAAAACCTTACAACCCATATGAGG
Long Flanking Sequence:
GTTCCCTTTGGGTGCTCCGGATTCCTCCACAGTCCAAAGACATGGGAAATTCTTTGGTTGAATTGTATACCTAAAAATTGTACAAGTCAATAAGGGTTAACTATATAGTATCGTTTCAACTGAAAATGGTTACTGTCCATTTTGACACCTATGGGTTTTTTGTCATTTTTGTCTCCAAAGAAAACCTGATGCCAGTCAAAGAGGAGAGTCAAGATCAGAACAAAGTAGAAGAGAAGGATCAGCATGAGGAATGTCTGGATTTCAGTTCTGGAGAAAAATCAGAACAGACAAAGACCTCATCACAAACAACAGCCGAATCTTATACCTGCCACCAGTGTGGAAAGAGTTTCACACGGAAACAAAACCTCACAAAACATATGAGGATTCACACTGGAGAAAAGCCTTACACTTGCCAACAGTGTGGAAAGAGTTTTAATCGGAGAGAAAACTTGAAAGAGCATATGAAGATTCATAATGGAGAAAAACTTTACACTTGCCAA[C/T]AGTGTGAAAAAAGTTTCACTTGGAAACAAAACCTTACAACCCATATGAGGATTCACACTGGAGAAAAGCCATTCAATTGCCATTATTGTGGAAAGAGTTTCACTTGTAAACAACACCTTACAGACCATATGAAGATTCACAATGGAGAAAAGCCCCATGCCTGCCTACAGTGTGAAAAGAGTTTCACTTGGAAACATCACCTTGTAACCCATATGAGGATTCACACTGGAGAAAAACAACACAGCTGCCTACAGTGTGGAAAGGCTTTCACACGGAAACTAAACCTTACAAAACACATGAGGATTCACACTGGAGAAAAACCTTACAATTGCCAACAGTGTGGAAAAAGTTTTTCTTGGAAACAATACCTTACAGACCATATGAGGACTCACACTGCTCACACTGCAGAAAAGCAACATACCTGCCACCAGTGTGGAAAAGGTTTCACTTGCAAACGAAACCTTTTAAATCATATGATTATTCACACAGGAGAAAAGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11718
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000137870 Nonsense 323 771 1 3
Genomic Location (Zv9):
Chromosome 15 (position 891521)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 931824
GRCz11 15 892627
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATGGAGAAAAGCGTTATACCTGCCTACAGTGTGGAAAGAGTTTCTCYTG[G/A]AATCGTCACCTTGCCATCCATATGAGGATTCACACTGGAGAAAAGCCTTA
Long Flanking Sequence:
ACAAAACACATGAGGATTCACACTGGAGAAAAACCTTACAATTGCCAACAGTGTGGAAAAAGTTTTTCTTGGAAACAATACCTTACAGACCATATGAGGACTCACACTGCTCACACTGCAGAAAAGCAACATACCTGCCACCAGTGTGGAAAAGGTTTCACTTGCAAACGAAACCTTTTAAATCATATGATTATTCACACAGGAGAAAAGCCTTACACTTGCCAACAATGTGGAAAGAGTTTCAATCGGAGGCAAAACTTAAAAGAACATGAGAAGATTCACAATGGAGAAAAACTTTACATTTGCCAACAGTGTGGAAAGAGTTTCGCTCGCAAACAATACCTTATAATCCATATGAGGATTCATACAGGAGAAAAGCCTTACAATTGCCAACAGTGTGGAAGGAGTTTTACCTATCAACAACACCTTACAGACCATATGAGGATGCTCCATGGAGAAAAGCGTTATACCTGCCTACAGTGTGGAAAGAGTTTCTCTTG[G/A]AATCGTCACCTTGCCATCCATATGAGGATTCACACTGGAGAAAAGCCTTACACTTGCCAGCAATGTGGAAAGAGTTTTAATCGGAGGCAAAACTTAAAAGAGCATATGAAGATTCATAATAGAGAAAAGCTTTACACTTGCCTACAGTGTGGAAAGAGTTTCACTTGGAAACAAAACCTTACAATCCATATGAGGATTCACACTGGAGTAAAGCCGTTCAATTGCCAACAGTGTGAAAAGAGTTTCACTTGTAAACAACACCTTACAGACCATGTGAGGATTCACACTGGAGAAAAGCCTTACACTTGCCAACAATGTGGAAAGACTTTCTCACGGAAACAATACCTTACACACCATATGAGGATTCACACTGGAGAAAAACGACACAACTGCCTACATTGTGGAAAGAGTTTCACTTGGAAACATCACCTTGTAACCCATATGAGGATTCACACTGAAAAAAAGCCTTACAATTGCAAACACTGTGGAAAGGGTTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39019
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000137870 Nonsense 408 771 1 3
Genomic Location (Zv9):
Chromosome 15 (position 891774)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 932077
GRCz11 15 892880
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGAGTAAAGCCGTTCAATTGCCAACAGTGTGAAAAGAGTTTCACTTGT[A/T]AACAACACCTTACAGACCATGTGAGGATTCACACTGGAGAAAAGCCTTAC
Long Flanking Sequence:
AAAACTTAAAAGAACATGAGAAGATTCACAATGGAGAAAAACTTTACATTTGCCAACAGTGTGGAAAGAGTTTCGCTCGCAAACAATACCTTATAATCCATATGAGGATTCATACAGGAGAAAAGCCTTACAATTGCCAACAGTGTGGAAGGAGTTTTACCTATCAACAACACCTTACAGACCATATGAGGATGCTCCATGGAGAAAAGCGTTATACCTGCCTACAGTGTGGAAAGAGTTTCTCTTGGAATCGTCACCTTGCCATCCATATGAGGATTCACACTGGAGAAAAGCCTTACACTTGCCAGCAATGTGGAAAGAGTTTTAATCGGAGGCAAAACTTAAAAGAGCATATGAAGATTCATAATAGAGAAAAGCTTTACACTTGCCTACAGTGTGGAAAGAGTTTCACTTGGAAACAAAACCTTACAATCCATATGAGGATTCACACTGGAGTAAAGCCGTTCAATTGCCAACAGTGTGAAAAGAGTTTCACTTGT[A/T]AACAACACCTTACAGACCATGTGAGGATTCACACTGGAGAAAAGCCTTACACTTGCCAACAATGTGGAAAGACTTTCTCACGGAAACAATACCTTACACACCATATGAGGATTCACACTGGAGAAAAACGACACAACTGCCTACATTGTGGAAAGAGTTTCACTTGGAAACATCACCTTGTAACCCATATGAGGATTCACACTGAAAAAAAGCCTTACAATTGCAAACACTGTGGAAAGGGTTTTTCTTGTAAAGAATACCTTACAGACCATATGAAGATTCACACTGGAGAAAAACGATATAGCTGCCTACAGTGTGGAAAGGGTTTCACACGGAAACTAAACCTTACAAAACACATGAGGATTCACACTGGAGAAAAGCCTTCACTTGCCAACAGTGTGGAATAAGCTTTGCATGTACAAAATCCCTTAATACCCATGTGATGCGTCATACTGGATAGAAGCCTGACACCTGTGTTTTTGACAAAAAGTAAATCTTAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28381
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000137870 Essential Splice Site 521 771 2 3
Genomic Location (Zv9):
Chromosome 15 (position 898329)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 938632
GRCz11 15 899435
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGAAGAAAAACATAATATCTGCCTACATTGTGGAAAAAGTTTCACTTG[G/A]AAAAAAGACCTTACGATACATATGAGGATTCACACTGGAGAAAAGCCATT
Long Flanking Sequence:
AACGACCATGTAAAATACTTGGAAATTCTTTGGTTGAATTGTATACCTAAAAATTGTACAAGTCAATAAGGGTTAACTATATAGTATCGTTTCAACTGAAAATGGTTACTGTCAATTTTAACACCTATGGGTTTTTTTGTCCTTTTTGTCTCTAAAGAAAACCTGATGCCAGTCAAAGAGGAGAGTCAAGATCAGAACAAAGTAGAAGAGAAGGATCAGCATGAGGAATGTCTGGATTTCAGATCTAGAGAAAAATCAGAACAGACAAAGACCTCATCACAAACAACAGCCGAATCTTATACCTGCCACCAGTGTGGAAAGAGTTTCACACGGAAACAAAACCTTTCAGCCCATTTGAGGATTCACACTGGAGAAAAGCCTTACACTTGCCAACATTGTGGAAAGAGTTTTACACGGAAACAAAACCTTTCAGCCCATATGAAGATGCACAATGAAGAAAAACATAATATCTGCCTACATTGTGGAAAAAGTTTCACTTG[G/A]AAAAAAGACCTTACGATACATATGAGGATTCACACTGGAGAAAAGCCATTCAATTGCCAACAATGTGGAAAGAGTTTCAATCGGAGACAAAACTTGAAAGAACATGAGAAGATTCACAATGGAGAAAAGCCTTACACTTGCCAACAGCATGGAAAGAGTTTCAATCGGAGACAAAACTTAAAAGAACATGAGAAGATTCACAATGGAGAAAAGCCTTACACTTGCCAACAGTGTGGAAAGAGTTTCGCTCGCAAACAATACCTTACAACCCATATGAGGATTCACACTGGAGAAAAGCCATTCAATTGCCAACATTGTGGAAAGAGTTTCACTTATAAACAACACCTTACAGACCATGTGAGGATTCACACTGGAGAAAAACCTTACACTTGTCAACAATGTGGAAAGAGTTTTAATCGGAGAGAAAACTTAAAAGAGCATATGAAGATTCATAACGGAGAAAAGCTTTACACTTGCCAACAGTGTGGAAAGAGTTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6361
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000137870 Nonsense 584 771 2 3
Genomic Location (Zv9):
Chromosome 15 (position 898519)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 938822
GRCz11 15 899625
KASP Assay ID:
554-5352.1 (used for ordering genotyping assays)
KASP Sequence:
GCCAACAGYRTGGAAAGAGTTTCAATCRGAGACAAAACTTAAAAGAACAT[G/T]AGAAGATTCACAATGGAGAAAAGCCTTACACTTGCCAACAGTGTGGAAAG
Long Flanking Sequence:
ATCAGAACAAAGTAGAAGAGAAGGATCAGCATGAGGAATGTCTGGATTTCAGATCTAGAGAAAAATCAGAACAGACAAAGACCTCATCACAAACAACAGCCGAATCTTATACCTGCCACCAGTGTGGAAAGAGTTTCACACGGAAACAAAACCTTTCAGCCCATTTGAGGATTCACACTGGAGAAAAGCCTTACACTTGCCAACATTGTGGAAAGAGTTTTACACGGAAACAAAACCTTTCAGCCCATATGAAGATGCACAATGAAGAAAAACATAATATCTGCCTACATTGTGGAAAAAGTTTCACTTGGAAAAAAGACCTTACGATACATATGAGGATTCACACTGGAGAAAAGCCATTCAATTGCCAACAATGTGGAAAGAGTTTCAATCGGAGACAAAACTTGAAAGAACATGAGAAGATTCACAATGGAGAAAAGCCTTACACTTGCCAACAGCATGGAAAGAGTTTCAATCGGAGACAAAACTTAAAAGAACAT[G/T]AGAAGATTCACAATGGAGAAAAGCCTTACACTTGCCAACAGTGTGGAAAGAGTTTCGCTCGCAAACAATACCTTACAACCCATATGAGGATTCACACTGGAGAAAAGCCATTCAATTGCCAACATTGTGGAAAGAGTTTCACTTATAAACAACACCTTACAGACCATGTGAGGATTCACACTGGAGAAAAACCTTACACTTGTCAACAATGTGGAAAGAGTTTTAATCGGAGAGAAAACTTAAAAGAGCATATGAAGATTCATAACGGAGAAAAGCTTTACACTTGCCAACAGTGTGGAAAGAGTTTTACTTGGAAACAAAACTTTACAATCCATATGAGGATTCACACTGAAGAAACACCATTCAATTGCCAACATTGTGGAAAGAGTTTCACTTATAAACAACATCTTACAGACCATGTGAGGATTCACACTGGAGAAAAGCCTTACAATTGCCAACATTGTGAAAAGAGTTTCTCACGGAAACGATCCCTTAAAGAT
Associated Phenotype:
Not determined