Busch Lab

ZMP

si:dkey-240n22.1

Ensembl ID:
ENSDARG00000095696
ZFIN ID:
ZDB-GENE-070705-407
Description:
Novel NACHT domain containing protein [Source:UniProtKB/TrEMBL;Acc:B0S5A0]
Human Orthologue:
NLRP6
Human Description:
NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
Mouse Orthologue:
Nlrp6
Mouse Description:
NLR family, pyrin domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2141990]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa44596 Nonsense Mutation detected in F1 DNA Not yet available
sa40340 Nonsense Mutation detected in F1 DNA Not yet available
sa38445 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa44596
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133855 Nonsense 26 107 3 5
ENSDART00000134357 None None 975 None 7
ENSDART00000135345 Nonsense 26 527 3 7
Genomic Location (Zv9):
Chromosome 4 (position 60965162)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75445961
GRCz11 4 77022699
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTTTGTCTCTTCAGTGTGAGATCAGGATCATGTGTGAAGAGTGACTG[G/A]TCTAAAGAGGATCCACCAGAGTTCAGTGAGGAAACACCATCACCTGCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40340
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133855 None None 107 None 5
ENSDART00000134357 Nonsense 89 975 2 7
ENSDART00000135345 Nonsense 250 527 7 7
Genomic Location (Zv9):
Chromosome 4 (position 60971415)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75452214
GRCz11 4 77028952
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTTCTAGATGTCATCAGTCACTAGAGATGAAGATTGAATGTAAACATT[T/A]GTTTGAAGCAGCTGAACAAGACAAGCAGATCAGAACTGTCCTGACAAAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18794
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133855 None None 107 None 5
ENSDART00000134357 Nonsense 280 975 2 7
ENSDART00000135345 Nonsense 441 527 7 7
Genomic Location (Zv9):
Chromosome 4 (position 60971987)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75452786
GRCz11 4 77029524
KASP Assay ID:
2259-5246.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAGACTCACAGATCAGAATCAGGCCAGAGAAATCATTGATCACATTAAA[C/T]AGTCAAAGAGTCTCTTTATTATGTGCCACATCCCAGTCTTCTGCTGGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38445
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133855 None None 107 None 5
ENSDART00000134357 Essential Splice Site 727 975 5 7
ENSDART00000135345 None None 527 None 7
Genomic Location (Zv9):
Chromosome 4 (position 60980841)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75461640
GRCz11 4 77038378
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCATGTGTGATTGTCCAACAGTGTGATGTGGACTGTTTGTGTGTTTGTA[G/A]ATTGTCTGGCTGTATGGTGACAGAGGAAGGCTGTGGTTTGCTGTCTTCAG
Associated Phenotype:
Not determined