Busch Lab

ZMP

si:dkey-79f11.8

Ensembl ID:
ENSDARG00000095673
ZFIN ID:
ZDB-GENE-030131-4806
Human Orthologues:
IFI44, IFI44L
Human Descriptions:
interferon-induced protein 44 [Source:HGNC Symbol;Acc:16938]
interferon-induced protein 44-like [Source:HGNC Symbol;Acc:17817]
Mouse Orthologues:
H28, Ifi44
Mouse Descriptions:
histocompatibility 28 Gene [Source:MGI Symbol;Acc:MGI:95975]
interferon-induced protein 44 Gene [Source:MGI Symbol;Acc:MGI:2443016]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa31189 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31189
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138187 Nonsense 76 324 3 7
ENSDART00000145441 None None 110 None 3
Genomic Location (Zv9):
Chromosome 1 (position 6966238)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 7264163
GRCz11 1 7948274
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGCCCTGAAAGAAAAGCTGGAAAACTTCTCTCCCAGTGATCCAGAAGTA[A/T]AAGACATCAAGGTCCTGGTGGCTGGACAAGTTGGAGCAGGAAAGTCCAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1994
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138187 Essential Splice Site 264 324 6 7
ENSDART00000145441 Essential Splice Site 57 110 2 3
Genomic Location (Zv9):
Chromosome 1 (position 6967141)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 7263260
GRCz11 1 7947371
KASP Assay ID:
554-3103.1 (used for ordering genotyping assays)
KASP Sequence:
CAAAAGTGAYCTACAAAAGGTCTACACSAGCAAGAAGATCAAAGAGAAGG[T/A]ATGCRATCAYTCACAGATACGTANNNNTTATGCTTTTATATACTGCTAAAACAC
Associated Phenotype:
Not determined