Busch Lab

ZMP

si:dkey-222h21.7

Ensembl ID:
ENSDARG00000095578
ZFIN ID:
ZDB-GENE-081031-33
Description:
Novel NACHT domain containing protein [Source:UniProtKB/TrEMBL;Acc:B8JIK4]
Human Orthologue:
NLRP6
Human Description:
NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
Mouse Orthologue:
Nlrp6
Mouse Description:
NLR family, pyrin domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2141990]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa19628 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19628
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131475 Nonsense 18 207 1 1
ENSDART00000132546 Nonsense 13 861 1 8
Genomic Location (Zv9):
Chromosome 1 (position 58968907)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57546855
GRCz11 1 58282537
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCACAAAGCCATCATGAGGAACAAGTATGATAGATTATATGAAGGAATC[A/T]AACTACAAGAGACCGAAACCCTCCTAAACCGGATCTACACCCAGCTGTAC
Long Flanking Sequence:
TGCCTACACCAGCCTGCCATCTCTCAGCATGGCCACGGGCAACTCTAGAGTAGGTGAGAGTCCAGATCTTCTTGAGAACTTGGGTGCCAGAGCTATGGAGGCGAGGCCTGCTACTGCTCCGCCTCCTCCCTGGCCTTCAACCACTGCCCAATCTGCATTTCACCATCCCCATACAACTCCTCCTGCAGGTGGAGTGTCAAATGAGAGATTGCACATGCATTCAAGCCCTGACCACAGGTCTGGCTCCAGTGTCCCTGGATGCACCATGAAGTGCATCACTTTTCTCATAAGGGTTTTTAGAGAAACAAAAAAAAAACTCTTACTGTTTTTAAAAATATCTGCAGCAGTGGACTGATCAGATCTGTCATCTATTTCCCCTTACATTAGGCAAAAGAACACAGTAATTGTCCACCAAACACAAGATTGAAAACATGCAGAGAGTCAAAGACAAGCACAAAGCCATCATGAGGAACAAGTATGATAGATTATATGAAGGAATC[A/T]AACTACAAGAGACCGAAACCCTCCTAAACCGGATCTACACCCAGCTGTACATCATAGATGGAGAGAGTGGAGGAGTAAATGAAGAACATGAGGTTTTACAGATGGAGAAAACAGCCAGAACAAAACACTCCCAACACACTCCAATCTACTGCAATGACATCTTTAAAGAGGAGAAAGAGCAAATCAAGACTGTTCTTACTAAAGGCATCGCTGGAATCGGAAAAACCGTCTCTGTGCAGAAGTTCATTCTGGACTGGGCCGAGGGAAAAGCCAATCAGGATGTAGATTTCATGTTTGTGCTTCCATTTCGAGAGCTGAACTTGATCAGAGATCATCAGTACAGTCTTCACACACTTCTGCTGGACTTTCATCCTGAACTTGAAGATCTGGAGCCCAAGATTTATGAGGAGTGTAAAGTTGTGTTCATCTTTGATGGTCTGGATGAAAGCAGAATCACACTGATGTTTTCAGACGCTCAGAAAGTTTGTGATGTGACTGAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6609
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131475 None None 207 None 1
ENSDART00000132546 Essential Splice Site 575 861 3 8
Genomic Location (Zv9):
Chromosome 1 (position 58970645)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57548593
GRCz11 1 58284275
KASP Assay ID:
554-4744.1 (used for ordering genotyping assays)
KASP Sequence:
ACTGCTTTGTTTCTTGCATATATTTACCTMGTAYTAAATTMCCTTGTTCT[C/G]CTCTTCTTTCAGTCTTGCTGGCTGTAATCTCTCTGCTCAGGATTGTGAAA
Long Flanking Sequence:
AACCATTGAGAGTGAGAATGGGCGTCTGGATCTGTTCCTGCGGTTCCTGCTGGGCGTCTCACTGGAGTCCAATCAGAGCCTCTTCCAGGATCTACTGACACACACAGAGAAGAGCTCAGAGAGCATCAGGAGAAGCACACAGTACATTAAAGAGAAGATCAGAGATGGACATGGACTCTCCACTGAAAGATCCATCAATCTGTTCCTCTGTCTGCAGGAAGTGAAAGATCAGACTCTGTCCAGAGAGATTCAGGAGTTTGTGAAATCAGACAAACAGTCAGAGAAGAAACTCTCTCCTGCTCACTGCTCAACAATCGCCTACATGCTTCAGATGTCAGAGGAGGTGCTGGATGAGCTGGAGCTCCACAAATACAACACATCAGATGAGGGCAGGAGAAGACTGATACCAGCCGTCAGCAACTGCACAAGAGCCCTGTGAGTGTTTATGTTACTGCTTTGTTTCTTGCATATATTTACCTCGTATTAAATTACCTTGTTCT[C/G]CTCTTCTTTCAGTCTTGCTGGCTGTAATCTCTCTGCTCAGGATTGTGAAATTGTGTCGTCAGTTCTTCAATCCTCAAACTGTGTCCTGAGAGAGCTGGACCTGAGTAACAATGACCTGCAGGATTCAGGAGTGAAGCTGCTCTCTGATGGACTGAAGAGTCCAAACTGTCAGCTGGAGATACTGAGGTATTAAGAACATATAAAAGAGAGAATTATGTCAATATCTGTAGATGATCCATCTGTTTGTGCTTTGGTGTCTGCAGGTTGTCTGGCTGTATGGTGACAGAGGAAGGCTGTGGTTTTCTATCTTCAGCTCTGAGTTCAAACCCCTCACACCTGAGAGAGCTGGATCTGAGCTACAATCACCCAAGACAATCAGGAGTCCAGCTGCTCCAACACACACTAGAGAAACTCAAGTAAGTGTGACAAAATCATTCATTGATTCATTTGTGAGTGTTTACGTGAGTTTGCAAACATCCATTATTATGCTTTGGAAGAAT
Associated Phenotype:
Not determined