Busch Lab

ZMP

si:dkey-58f10.13

Ensembl ID:
ENSDARG00000095532
ZFIN ID:
ZDB-GENE-060526-315
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2BHK7]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
hu7901 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
hu7901
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000136949 Splice Site, Nonsense 16 232 2 5
Genomic Location (Zv9):
Chromosome 5 (position 40264774)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 38064164
GRCz11 5 38664317
KASP Assay ID:
554-2392.1 (used for ordering genotyping assays)
KASP Sequence:
AAATGATATATATTTCATAACAGTTTATCTTTTTACTTTTGTACACAGGC[C/T]AGACGATGGATAGGTTTATAGATGATTTCCATAAGAATCTTCGAAAGGAA
Associated Phenotype:
Not determined