Busch Lab

ZMP

si:dkey-265e7.1

Ensembl ID:
ENSDARG00000095293
ZFIN ID:
ZDB-GENE-081103-25

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa26325 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa26325
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131790 Nonsense 279 1009 1 7
ENSDART00000143196 Nonsense 351 650 5 5
Genomic Location (Zv9):
Chromosome 4 (position 32061139)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 32745542
GRCz11 4 32640925
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTATTATGTGCCACATCCCAGTCTTCTGCTGGATTTCAGCCACTGTTCTC[C/T]AGAACATACTAAAACTGAAACACAGGGCTCATGCTGAGACACTGCAGGAA
Associated Phenotype:
Not determined