Busch Lab

ZMP

si:ch211-278p9.2

Ensembl ID:
ENSDARG00000095274
ZFIN ID:
ZDB-GENE-081028-37
Human Orthologue:
NLRC5
Human Description:
NLR family, CARD domain containing 5 [Source:HGNC Symbol;Acc:29933]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa22998 Nonsense Available for shipment Available now
sa28799 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa22998
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000144941 Nonsense 225 466 1 1
Genomic Location (Zv9):
Chromosome 17 (position 7323730)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7326504
GRCz11 17 7483682
KASP Assay ID:
2261-0597.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTTCCCTCTGCTCTCATCTGGATCACCTCCAGACCAGCAGCAGCCAAT[C/T]AGATCCCTTCAAAATACATCAGCCGTCTGACAGAAATTCAGGGATTTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28799
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000144941 Nonsense 359 466 1 1
Genomic Location (Zv9):
Chromosome 17 (position 7323326)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7326100
GRCz11 17 7483278
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTGCTGAACTGGCTTTCAATCAGCTGATGAAGGGCAATGTGATGTTCTA[T/A]GAAGAGGACCTGATTGAGAGCGGCATAGACGTCACTGATGCTGCAGTGTA
Associated Phenotype:
Not determined