Busch Lab

ZMP

zgc:153720

Ensembl ID:
ENSDARG00000095234
ZFIN ID:
ZDB-GENE-060929-982
Description:
hypothetical protein LOC767719 [Source:RefSeq peptide;Acc:NP_001070125]
Human Orthologues:
VWDE, WIF1
Human Descriptions:
WNT inhibitory factor 1 [Source:HGNC Symbol;Acc:18081]
von Willebrand factor D and EGF domains [Source:HGNC Symbol;Acc:21897]
Mouse Orthologue:
Wif1
Mouse Description:
Wnt inhibitory factor 1 Gene [Source:MGI Symbol;Acc:MGI:1344332]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa7384 Missense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa7384
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084891 Missense 76 189 2 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 39845341)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 38764740
GRCz11 1 39482813
KASP Assay ID:
554-4292.1 (used for ordering genotyping assays)
KASP Sequence:
ACGGAGGCCACGTCAAAGAGATGGTCCACCGAGAGGCAGACGARTATAGC[C/T]GCCARGKTGAGTCGCCCATGACTTCACCCMGTCCACAGGTCACATGACAC
Long Flanking Sequence:
AAACTCTCTCACACTGTCCCCTGAAAGACGGTATCTCCCAACAGTCCAGAAGGTGTAAAGGATTTCTGAATCCTGGGAAGATTGTGTACAGCCTTGTGCTGTGTGACCGCTAGTTTACACTTTTTTTTAAAAGGAATTCTTTCTGTCTCTCTTTTCCAATCCCCTCCTCTCACTCTCCAGGTAGACAACAGTAAGCTCACATTTGGGCAGAGCCTGTGGCGAGCGAGCGCTCCGATTGGTTGCCGCCTTGTGTTTCACCGCGTCATGCGGGCAGGATGGATGTGAAAGAACGCAGGCCCTACTGCTCATTGACTAAGAGCAGGAGAGAGAAAGAGCGCCGCTACACGGGCTCATCGGGCGACAGCGAGGACTGTCGCGTGCCCACCCAGAAGTCCTACAGCTCCAGCGAGACGCTCAAGGCCTTCGACCACGACTCCTCACGTCTGCTTTACGGAGGCCACGTCAAAGAGATGGTCCACCGAGAGGCAGACGAGTATAGC[C/T]GCCAAGGTGAGTCGCCCATGACTTCACCCCGTCCACAGGTCACATGACACAAACTGGAAATAACATGTGCCTAAAAACACGTCAAGAATGCGCTCTTGGACGGATCGCACTCAGCTAATAATATATGGGATGCACAACCATAATTACACATAATTAGAGGAAATTAAGTTTGGTTTGGCACAACCGAGTGCTTTCTTTGAGAAAACATTTACTTACTTTTGATTGAAAAATGAAGCAGATTCAAAAACAAATTAGACAGATTTATGGACCCCAAATTTGCTCGGCTACTTGTCTAGTCGACAGAGCGAAGAATGAAGAAATAAGGCATTTCCTTAAGATTAGCAAAACCAAAACCCCCTCATCCCAGCCTCTCATTTTCACATCCTAAGTTTCCCTTAGAACATATGCCCATGTGTCCCATCGGCAGTAATGAATGGTACCATAAAAAACATAAACAGCATTATTGCACTGCTCTGAAGTTTGCAGTGTGCCCTGCCCGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4857
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084891 Essential Splice Site 77 189 2 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 39845348)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 38764747
GRCz11 1 39482820
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCACGTCAAAGAGATGGTCCACCGAGAGGCAGACGARTATAGCCGCCARG[G/T]TGAGTCGCCCATGACTTCACCCMGTCCACAGGTCACATGACACAAACTGG
Long Flanking Sequence:
CTCACACTGTCCCCTGAAAGACGGTATCTCCCAACAGTCCAGAAGGTGTAAAGGATTTCTGAATCCTGGGAAGATTGTGTACAGCCTTGTGCTGTGTGACCGCTAGTTTACACTTTTTTTTAAAAGGAATTCTTTCTGTCTCTCTTTTCCAATCCCCTCCTCTCACTCTCCAGGTAGACAACAGTAAGCTCACATTTGGGCAGAGCCTGTGGCGAGCGAGCGCTCCGATTGGTTGCCGCCTTGTGTTTCACCGCGTCATGCGGGCAGGATGGATGTGAAAGAACGCAGGCCCTACTGCTCATTGACTAAGAGCAGGAGAGAGAAAGAGCGCCGCTACACGGGCTCATCGGGCGACAGCGAGGACTGTCGCGTGCCCACCCAGAAGTCCTACAGCTCCAGCGAGACGCTCAAGGCCTTCGACCACGACTCCTCACGTCTGCTTTACGGAGGCCACGTCAAAGAGATGGTCCACCGAGAGGCAGACGAGTATAGCCGCCAAG[G/T]TGAGTCGCCCATGACTTCACCCCGTCCACAGGTCACATGACACAAACTGGAAATAACATGTGCCTAAAAACACGTCAAGAATGCGCTCTTGGACGGATCGCACTCAGCTAATAATATATGGGATGCACAACCATAATTACACATAATTAGAGGAAATTAAGTTTGGTTTGGCACAACCGAGTGCTTTCTTTGAGAAAACATTTACTTACTTTTGATTGAAAAATGAAGCAGATTCAAAAACAAATTAGACAGATTTATGGACCCCAAATTTGCTCGGCTACTTGTCTAGTCGACAGAGCGAAGAATGAAGAAATAAGGCATTTCCTTAAGATTAGCAAAACCAAAACCCCCTCATCCCAGCCTCTCATTTTCACATCCTAAGTTTCCCTTAGAACATATGCCCATGTGTCCCATCGGCAGTAATGAATGGTACCATAAAAAACATAAACAGCATTATTGCACTGCTCTGAAGTTTGCAGTGTGCCCTGCCCGGCCACAGT
Associated Phenotype:
Not determined