Busch Lab

ZMP

si:dkey-19a16.11

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa24068 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24068
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132889 Essential Splice Site 107 245 2 3
Genomic Location (Zv9):
Chromosome 22 (position 6123302)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 6169369
GRCz11 22 6199215
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACTGTTTATTAAATTTGTTCTCATTTCTCTACCTTGTCTGATGTTTTC[A/G]GCTCGTCTGCCTGTTCCGGTCCTCATCTTCAACTCTTCTCAGTGTTCCTC
Associated Phenotype:
Not determined