Busch Lab

ZMP

si:ch211-127n13.2

Ensembl ID:
ENSDARG00000095189
ZFIN ID:
ZDB-GENE-090312-72
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JKA4]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa39623 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39623
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135759 Nonsense 126 157 5 6
Genomic Location (Zv9):
Chromosome 1 (position 26497585)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 26837802
GRCz11 1 27531516
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACAGTGATGAGTTACCCTCTTCATCATCTTCATCGTCCTCCCTATCAT[C/A]ATCATCATCTGAAGATGAAAGATGTCACAAAAAAATCCAAAAAGAAGAAA
Associated Phenotype:
Not determined