Busch Lab

ZMP

ENSDARG00000095154

Ensembl ID:
ENSDARG00000095154

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa37537 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37537
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135189 Essential Splice Site 132 325 3 4
Genomic Location (Zv9):
Chromosome 22 (position 29834774)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 68244557
GRCz11 4 70270779
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTCTGGATCATGGAGGAGAGACGAGGATTACAGCAGGACTACGCAAAT[G/A]TAGGACTACACACACACACACACACTCTTACACACTCTCTCAAACACACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6714
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135189 Nonsense 239 325 4 4
Genomic Location (Zv9):
Chromosome 22 (position 29834083)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 68243866
GRCz11 4 70270088
KASP Assay ID:
554-5264.1 (used for ordering genotyping assays)
KASP Sequence:
GCATCAGGAGGAAGGGAGATGGTGTTGAGTGKGWGTTTGGATTTAATGCT[C/T]AGTCCTGGAGTTTGWTCTGTGATTCCTCCAGATTCTCATTCAGWCACAAT
Associated Phenotype:
Not determined