Busch Lab

ZMP

si:ch211-130m23.2

Ensembl ID:
ENSDARG00000095136
ZFIN ID:
ZDB-GENE-060531-13
Description:
hypothetical protein LOC794173 [Source:RefSeq peptide;Acc:NP_001108161]
Human Orthologues:
ARRDC2, ARRDC3, ARRDC4, TXNIP
Human Descriptions:
arrestin domain containing 2 [Source:HGNC Symbol;Acc:25225]
arrestin domain containing 3 [Source:HGNC Symbol;Acc:29263]
arrestin domain containing 4 [Source:HGNC Symbol;Acc:28087]
thioredoxin interacting protein [Source:HGNC Symbol;Acc:16952]
Mouse Orthologues:
Arrdc2, Arrdc3, Arrdc4, Txnip
Mouse Descriptions:
arrestin domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1918057]
arrestin domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2145242]
arrestin domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1913662]
thioredoxin interacting protein Gene [Source:MGI Symbol;Acc:MGI:1889549]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3559
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140636 Nonsense 396 441 7 7
Genomic Location (Zv9):
Chromosome 5 (position 47918646)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45707386
GRCz11 5 46307539
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACCTCCCCTGGRTCARTTTGGGGCTCYTGCTTTTCCTGGACCTCCAGGT[C/T]AGTCCGCTCCCTCWTATTACAGTGGAGCTCCGGGCCAGTTTGGTCCTTCA
Associated Phenotype:
Not determined