Busch Lab

ZMP

si:dkey-6e12.6

Ensembl ID:
ENSDARG00000095086
ZFIN ID:
ZDB-GENE-030131-5736
Description:
craniofacial development protein 1 [Source:RefSeq peptide;Acc:NP_001093505]
Human Orthologue:
CFDP1
Human Description:
craniofacial development protein 1 [Source:HGNC Symbol;Acc:1873]
Mouse Orthologue:
Cfdp1
Mouse Description:
craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa29037 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa32208 Essential Splice Site Available for shipment Available now
sa13566 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa29037
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079170 Essential Splice Site 181 353 4 8
ENSDART00000115388 Essential Splice Site 140 312 3 7

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 22199084)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22429307
GRCz11 18 22418373
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGATATCCCTAGACCCAAAGCAGAAGTTCCAAGTGCAAGCTCTCAGAAG[G/A]TAAAGTATCAGCTCAAGAATACAAACACAAATAAAAGAGGTTTTGTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32208
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079170 Essential Splice Site 225 353 None 8
ENSDART00000115388 Essential Splice Site 184 312 None 7

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 22201336)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22431559
GRCz11 18 22420625
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAAAATCACAATTACTAAGGTGTTCGATTTTGCTGGAGAAGAGGTTCGG[T/C]AAGTACAAGTCGTTTGTGTGGCCACTAGATGGCAGCATCTAATCATGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13566
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079170 Essential Splice Site 324 353 None 8
ENSDART00000115388 Essential Splice Site 283 312 None 7

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 22251713)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22481936
GRCz11 18 22471002
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGAGGGCATCACAGATGAGCTGGCAATCCATAATMGAGGCAAAGAAGGG[T/A]AWGTTTAAGCCTCATTAGTGACCCAGACAAACACATCATCTCGTATTATC
Associated Phenotype:
Not determined