Busch Lab

ZMP

casp8ap2

Ensembl ID:
ENSDARG00000095052
ZFIN ID:
ZDB-GENE-030826-8
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5RHP0]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa32289 Nonsense Available for shipment Available now
sa37022 Nonsense Mutation detected in F1 DNA Not yet available
sa23697 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32289
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037584 Nonsense 59 605 4 7
ENSDART00000128616 Nonsense 59 273 4 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 23931471)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24050272
GRCz11 20 23949372
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGTTAACACTATCCTTTCTCCACGGACCATGGAATCTATGGATATATA[T/A]GAGGAAATTATCAGAGAAGAACAAGAAGAAAAGGAAGCAACTTACAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37022
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037584 Nonsense 204 605 7 7
ENSDART00000128616 Nonsense 204 273 7 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 23932240)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24051041
GRCz11 20 23950141
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGTAAATCAGCAAACGGACAGGATCACTTCAACATCAATTTCAGCATCA[C/T]AGCCATTTGAGGTGCTCCAGAGATGTCCAAGAACTGAAAGTGAAAATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23697
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037584 Nonsense 408 605 7 7
ENSDART00000128616 None None 273 8 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 23932852)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24051653
GRCz11 20 23950753
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAAGAAAGCAGCAGACACGGAGGTGCAGAGTCAAGGGCACATGCATAAA[C/T]AAAACGCAGAAAGAACAAGCAGAGAAACGAGACAATCTGGATTGAGCAGT
Associated Phenotype:
Not determined