Busch Lab

ZMP

thsd7ba

Ensembl ID:
ENSDARG00000095022
ZFIN ID:
ZDB-GENE-070621-2
Description:
Novel protein similar to human and mouse thrombospondin, type I, domain containing 7B (THSD7B) [Sour
Human Orthologue:
THSD7B
Human Description:
thrombospondin, type I, domain containing 7B [Source:HGNC Symbol;Acc:29348]
Mouse Orthologue:
Thsd7b
Mouse Description:
thrombospondin, type I, domain containing 7B Gene [Source:MGI Symbol;Acc:MGI:2443925]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa8510 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa9262 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa8510
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132123 Essential Splice Site 367 1574 2 26
Genomic Location (Zv9):
Chromosome 9 (position 10575934)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 10379781
GRCz11 9 10351154
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GWAAAGGAGGCCTGCAACATCATTGGAGATCTGCTTCCAAACTGCCCAAG[G/A]TTTCTCTTTCATCCTCCCAATAATAAACTCCTAATGTACATGAATGTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9262
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132123 Essential Splice Site 1154 1574 16 26
Genomic Location (Zv9):
Chromosome 9 (position 10424608)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 10228455
GRCz11 9 10199828
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCCTGCATCCTCAACAGCACCTGCTTCAATTACCACTACAATGTYTCCAG[T/C]GGGTCTTACTCATTTTGCTACAACACAACACTGAATGTAACATGAGCTTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1046
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132123 Nonsense 1497 1574 24 26
Genomic Location (Zv9):
Chromosome 9 (position 10390353)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 10194200
GRCz11 9 10165573
KASP Assay ID:
554-0949.1 (used for ordering genotyping assays)
KASP Sequence:
CCCAGGCACCGACAACAAGAAGGCCGATGTGAAGACCAGCTCAGGAAGAT[T/A]AAGACCAGGCACGACTCAAATCCAGGACTTCTTCGGCGAGTGGTCCCTGC
Associated Phenotype:
Not determined