Busch Lab

ZMP

si:dkey-240n22.3

Ensembl ID:
ENSDARG00000095013
ZFIN ID:
ZDB-GENE-070705-409
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S5A2]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa33513 Nonsense Available for shipment Available now
sa9578 Nonsense Available for shipment Available now
sa9668 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33513
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134509 Nonsense 589 794 2 7
ENSDART00000142978 None None 320 None 6
Genomic Location (Zv9):
Chromosome 4 (position 60921756)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75402555
GRCz11 4 76979293
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGAGCTGGAGGAGTTTGAGCTTCACAAATTCCAGAGATCAGACGAGTG[T/A]CTCATCAGACTATCAGCAGTCATCAAAACCTCCAAAAGAGCTCTGTAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9578
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134509 Nonsense 782 794 7 7
ENSDART00000142978 None None 320 None 6
ENSDART00000134509 Nonsense 782 794 7 7
ENSDART00000142978 None None 320 None 6
Genomic Location (Zv9):
Chromosome 4 (position 60929724)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75410523
GRCz11 4 76987261
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTTGTGTACTGACTGAATGTGAATCTGTGTGTGTTTACAGTCTGGATYA[T/A]GGAGGAGAGACGAGGATTACAGCAGGACCACGCAAATGTAGGACTACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9668
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134509 Nonsense 782 794 7 7
ENSDART00000142978 None None 320 None 6
ENSDART00000134509 Nonsense 782 794 7 7
ENSDART00000142978 None None 320 None 6
Genomic Location (Zv9):
Chromosome 4 (position 60929724)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75410523
GRCz11 4 76987261
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTTGTGTACTGACTGAATGTGAATCTGTGTGTGTTTACAGTCTGGATYA[T/A]GGAGGAGAGACGAGGATTACAGCAGGACCACGCAAATGTAGGACTACACA
Associated Phenotype:
Not determined