Busch Lab

ZMP

ugt5a4

Ensembl ID:
ENSDARG00000094923
ZFIN ID:
ZDB-GENE-100406-1
Description:
UDP glucuronosyltransferase 5 family, polypeptide A4 [Source:RefSeq peptide;Acc:NP_001170969]
Human Orthologue:
UGT8
Human Description:
UDP glycosyltransferase 8 [Source:HGNC Symbol;Acc:12555]
Mouse Orthologue:
Ugt8a
Mouse Description:
UDP galactosyltransferase 8A Gene [Source:MGI Symbol;Acc:MGI:109522]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa24703 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30278
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122035 Nonsense 220 525 2 2
Genomic Location (Zv9):
Chromosome 25 (position 30372409)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28939770
GRCz11 25 29382777
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACATTCAGTCAGAGAGTCATGAACATGATGACATATATAATGATTCTTTA[T/A]AAAAATTCCAAGTACTTTGGTTCTCCTTACCAAGAGCTCACCCAGAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24703
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122035 Nonsense 362 525 2 2
Genomic Location (Zv9):
Chromosome 25 (position 30371985)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28939346
GRCz11 25 29382353
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGGCAACAATTCTTTGATTGTGAACTGGCTGCCCCAGAATGACTTGCTT[G/T]GACATCCTAAAACTAAACTGTTTGTAGCACATGGAGGCACCAATGGACTT
Associated Phenotype:
Not determined