Busch Lab

ZMP

B8JIF7_DANRE

Ensembl ID:
ENSDARG00000094906
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JIF7]
Human Orthologue:
EFCAB6
Human Description:
EF-hand calcium binding domain 6 [Source:HGNC Symbol;Acc:24204]
Mouse Orthologue:
Efcab6
Mouse Description:
EF-hand calcium binding domain 6 Gene [Source:MGI Symbol;Acc:MGI:1924877]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa32638 Essential Splice Site Available for shipment Available now
sa13689 Nonsense Available for shipment Available now
sa39582 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa32638
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131559 Essential Splice Site 50 152 1 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16404855)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16970023
GRCz11 1 17662960
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGGATGAAGGCAGAGTTTGATAAACTGGATCCTGAAAGCACCGGAAAG[G/A]TAGCAAACAGTGTCACACCTCTCAAACAAACAGGTAGAAAAATGGTAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13689
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131559 Nonsense 65 152 2 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16401389)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16966557
GRCz11 1 17659494
KASP Assay ID:
2259-0387.1 (used for ordering genotyping assays)
KASP Sequence:
TTTGCAGGTGAGAGGTGCGGACTTTCTGCAGGTGTTGGGAAAGTTTGAWT[T/A]GCAWCTGAAAAGAGAGCAGCTGGGTCTGTTTCTGTCTCGCTGTGGTCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39582
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131559 Nonsense 70 152 2 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16401375)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16966543
GRCz11 1 17659480
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGCGGACTTTCTGCAGGTGTTGGGAAAGTTTGATTTGCATCTGAAAAGA[G/T]AGCAGCTGGGTCTGTTTCTGTCTCGCTGTGGTCTGAAGATTAAAAAGGGT
Associated Phenotype:
Not determined