Busch Lab

ZMP

ABCC6 (3 of 3)

Ensembl ID:
ENSDARG00000094901
Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 6 [Source:HGNC Symbol;Acc:57]
Human Orthologue:
ABCC6
Human Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 6 [Source:HGNC Symbol;Acc:57]
Mouse Orthologue:
Abcc6
Mouse Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 6 Gene [Source:MGI Symbol;Acc:MGI:1351634]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa20081 Nonsense Available for shipment Available now
sa40117 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33249 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa20081
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131340 Nonsense 2 1462 1 30
Genomic Location (Zv9):
Chromosome 3 (position 36817924)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36681682
GRCz11 3 36823540
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCACAAAGTGCTTCCAGCACACGATACTGGTGTGGTTCCCTTGTTTCTA[T/A]CTCTGGATCTGTGCCCCTTTCTACTGCTTGTATCTCAAATTCTATTACAA
Long Flanking Sequence:
GAGGAAGGGAAAAAGAGTGGAGTCTGGATGGACACCCTCTGCAGTCTCAGTGGCCTGGACCCTCTCTGGGTAAGTCTTAGACCAGTTGGCGAGATCTGCCAGTTTGCAGGCACATGAGGAGTTAGGAGACTGCTGTCTAGTCTGACACGATCATGCTTTCTGTAGTGTGCTGAACCAACTAGCTAACATTTTCTTGCAGTATTAAATGTCTGAAGAAAATACAGGGCATCTTAATTTTATCTGTTTCTGTAGTTTCCAATATTTGAAAATAGTTTTCTCTAGTTCACAAATTGATAAAAAAATAACCGTTTAACTTGAACTCAGGTCTATAGATAATTATGCCTGTGTAGATATTTATAATTCCTTATGTTACATGTTAAGGAGTTTCAGAGGTCTAATGGTTTAATGTTTCAGGATTGGAACGTCACGTGGTACACAGAACATCCAGACCTCACAAAGTGCTTCCAGCACACGATACTGGTGTGGTTCCCTTGTTTCTA[T/A]CTCTGGATCTGTGCCCCTTTCTACTGCTTGTATCTCAAATTCTATTACAATGGACGCATATCTATATCCAGCCTCTGCTGTGCCAAGATGGTAAGTAATACTAGTCACGTTCTAGTTTTTATCCTAATGCCTTTCTAAAGACAAGAAATTAATTCTGTGGGAAGAACAGATAAACAGATCATATCACATCATAGCTGCCCTAAATAAAAAGGTGCACAAATGTGATTTTGAATGCCTTTTTTTGACCCTTCTGTTCAAAGATCTTACCATCTAAATATCATAAAGAACCTGTTTCAACAACAAAGAACATTTCATGCAACTGTACGGTAAAGACTAAAGGTTCTCTCATCGAACCCAATAAAGAACCCAAATTTTAAGTGTGTGTAAGTCAAGTCTAATAGGGAAAACAATACTGGTGAAAAGGTTTAGGGTCAGAAAGATCTCTCTCTCCTTAAATAATTGAACATTTTATTCTGCAAGAATGAATTAAGTTGCTCAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26118
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131340 Nonsense 84 1462 3 30
Genomic Location (Zv9):
Chromosome 3 (position 36816309)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36680067
GRCz11 3 36821925
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTGACCCCACTGTGTCCTCAGATACTGGTGATGTTGATGATCCACTTA[G/T]AAAGGCTGAGGGGCTTTCGTTCCTCTGTGTTTCTCTTTCTGTTTTGGATG
Long Flanking Sequence:
GAAAAGCATCAAAGACTCAACCGTCCCCCAACATTAGAATAGACATGCAAGTAAAACATTTGTTGAGGGAATGACAGAATAGTGTTGCTCACATGTTTTTGTGCACATCTTGTAGGGTTTGGCTCTCTGTCTGGCCTCCATTGGTTTTTTGGAGACGGTCTACCTGCTGGTGGAAAGAAGCAGAGACATAGAGCATCTCATGGTCTTTCTCCTGAGCCCTATTATCCGTAGCCTTACCATGGTAAATCACACTATTAATATTCTGAACCTCCACATTGATAACTATATGTAAATTATTTAAAAGTATATGGTATTAAGATTCAAATGACTCTATTTCAAAATTTTCATTGTTATGAAACATGAAACTCAGAAAAACATTAAGTCTAAAGTCATAATTCAAATTGTTTAAAAATATGGTCAAATGCTCCAAAATGTTTTTGGATGTTTCTAAACTGACCCCACTGTGTCCTCAGATACTGGTGATGTTGATGATCCACTTA[G/T]AAAGGCTGAGGGGCTTTCGTTCCTCTGTGTTTCTCTTTCTGTTTTGGATGCTTTCGGTGGTCTGCTCACTGGTGCCTCTCAGAGCCAACATACAAGCCAACATAAAGGAGGTCTGTACATCAACACTATTATCCCACAGTGGTATAACAAAATAATTGATTATGGGTAACACATTATTAAATGTCACCTTTGTCCCGCTGATGATCATTAACTACATCAGCTTGTAGTCATTAGAGTTTCAGTCTTCTCAATGTCTGCTGACACTTTATTGTGATCATCTCACAACTGAAGTTCAACTAGTACAAGTAATTTTACAAGTACGCATAACTTATTTTACTAACGCTATCAATAACATACTATTTCAGTCAACAAGTAATATTCTACATTTACATGAGTACATGTAATTTATTAATAATAATGCAGTAATTAAAAGATAGTTTTATCATAGTTTTATGAGTAAATTCAGCACAGATTGTAAAAATTCAGAGAAAGTTATCTAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26117
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131340 Essential Splice Site 442 1462 11 30
Genomic Location (Zv9):
Chromosome 3 (position 36811639)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36675397
GRCz11 3 36817255
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGCTTCAAGTCTACAGATATTCTGAACTCGCATGCATTTACTGCTTTC[A/C]GGAGGTCCAGATGAAACATAAGGATGAACGCATAAAGTTGATGAACGAAA
Long Flanking Sequence:
TTCATTGTATGTACTTATTCGACATAATTAATTACTTCATTTGTTTTATTATTGTTTCTGTTAGTTTTTAATTTCCAATATTGTTATTTAATCACAAATAAAGATAAAAATATATACGCATAGGAGTATTTCCACCTCACGTAAAAGCCTAGATTGAAGGACAATGAGTACACATTTAGAATCTTTACCCAGTGGCAAGCTGTTTTGTACGTTAAAGTATAATTTTGCAGTTTTTTCTGAGAGTAAATCAATTTCAATGTTGTTAATGACAAAATTTTCTAATTTTTTAATTCTTTCAATGTCTCGCCCCTGTGCAGCATCTCGGTCCATCCACCTTGGCTGGCATCACCACTGTGATACTCATCTTTCCTTTAAATGGGTTTATTGCCAAAATGAGAAGCAAGCTCCAGGTATTGTCCATGTTGTTCCACTGAGACACAGTGTCGTCAATCTGCTTCAAGTCTACAGATATTCTGAACTCGCATGCATTTACTGCTTTC[A/C]GGAGGTCCAGATGAAACATAAGGATGAACGCATAAAGTTGATGAACGAAATCTTGAGTGGCATAAAGATCCTTAAGTTTTATGCCTGGGAAAAGGCCTTCAGAGAGCGAGTGCTGGGATACAGGGAAAAAGAGCTGAATGCTCTGAAGAAGTCCCAGATACTTTACTCCGTTTCCATCGCCTCCTTTAACTCATCAACATTATTGGTATATTTCAGAGACATCAGCAAAACCATATTTTTTCAAATAATCCTAACATTTATATAATTATATGGCTTACTCTACTTTGCCTACAGATTGCGTTTGCCATGTTCGGGGTGTATGTGCTAATTGATGATAAGCATGTTCTGGATGCTCAGAAAATCTTTGTGTCCATGGCTCTTATCAACATACTTAAAGCTCCACTCAGTCAACTGCCAATTGCAATGAGCACTACTATGCAGGTGAGCATCAGTAATATATGCACTATATGTATTATAATGTTAAAGCACTTTATTTAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40117
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131340 Essential Splice Site 713 1462 17 30
Genomic Location (Zv9):
Chromosome 3 (position 36807656)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36671414
GRCz11 3 36813272
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGCATCGTATCACAAGAGACAATGCTAACTACATTTTTACAATGTTCAC[A/T]GGGGTTAAATCTGTCAGGAGGTCAAAAACAGAGAGTAAGTCTGGCACGAG
Long Flanking Sequence:
AGAATCAATGTCAAAGTTCAGCGAGGTTCACTGGTGGCTGTAGTTGGTCATGTGGGCAGTGGAAAATCCTCTCTCTTGTCTGCAATGCTTGGAGAAATGGAAAAGAAAAGTGGCCACATCACAATCACGGTAAATGTAGGAACATCATTAAAATATATATTTGCATCCATTAAATACATAATTTTGCTAACACTTTCTTTTAGGGCTCTGTGGGTTATGTTCCTCAGCAAGCATGGATCCAGAATGCCACTCTTAAAGACAACATTTTGTTTGGATGTGAGAAGAAAGACAGTTTGTACCAGAAAGTACTGGAAGCCTGTGCCCTCCTACCAGACTTAGAGATCCTTCCTGCACGAGATGCAACAGAGATTGGAGAGAAGGTGCATAATATGGATTAGTTTTTATGTATTGTGGGAAAAGCTATTAAATGTGAGCTTATACATTACAAATATGCATCGTATCACAAGAGACAATGCTAACTACATTTTTACAATGTTCAC[A/T]GGGGTTAAATCTGTCAGGAGGTCAAAAACAGAGAGTAAGTCTGGCACGAGCAGTATACAGGAATTCTGATATCTATCTGTTGGATGATCCCTTGTCAGCGGTGGATGCACATGTGGGTCAACACATCTTTGAAAAAGTCATTGGACCTAATGGATCTCTTAAAAATAAGGTACAATTTAAAATATAAATAGGATGAATAAAAATATGTCAATTCTAATATAGAAAATGCTATATTCTAAATTAAAGTATATAAGTCCACAACTGAACGGCAATGACACAATTTTCTATGGTAGTGACTATGACTAATTTACTTCAAGAGATATGATATAAGTTTATTACACATGCACACACGTATGCAGTAGGCCCCCTTTTGCCTTTTGACATGTTCAGCAACAATACTTAGGTTGGTTGTGGCATTGACGTGATGCTCAATTGGTACTAATGGGCCCAAAGTGTGCCAAGAAAATATCCCCCACATAATTACACCACCACCAGCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33249
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131340 Nonsense 1263 1462 27 30
Genomic Location (Zv9):
Chromosome 3 (position 36803143)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36666901
GRCz11 3 36808759
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCCATTCATCAAATCCAATCAGGTTGGAATTGTGGGAAGAACAGGAGCT[G/T]GAAAATCATCTCTGGCTCTTGGAATCTTTCGTATCCTTGAGGCAGCAAAA
Long Flanking Sequence:
ATTTCATACAAGAAATTCTAAAGGCAATTCACACTGCAGGTCACCGGGATTCTAAGCTGGATTGTGCGGTCATGGACTGATGTAGAAAACAACATTGTGTCTGTTGAGCGAGTGAAAGAATATGCTGAAACGGCAAAAGAGGTAGTGCTGTTTCTGCAATAAATTTCCTTGCAATGAGTGACCAAATTAAATGTGTATGGTTATTCTTGAGATTACCAAGTTTGTTTTGTGTTGGCACAGGCACCATGGACATTCGAGGACAGTCCACTCCCGTCTGACTGGCCCAGATCCGGATCTATTGGATTCCAGGCATATGGACTTCAGTATCGCAAGGGTCTTGACTGGGCCTTGAAAGAAATTTCCCTCAGTGTCAATGAGAGAGAAAAAGTAAATATAACAATTGGAGGAATTTAATACATTTTTTCATATTTCATCATTTAATATATGCTAAGCCATTCATCAAATCCAATCAGGTTGGAATTGTGGGAAGAACAGGAGCT[G/T]GAAAATCATCTCTGGCTCTTGGAATCTTTCGTATCCTTGAGGCAGCAAAAGGAAAGATCTTTATAGATGGCATAAACATAGCAGAGATTGGACTGCATGAACTGAGGTCTCGTATCACTATCATCCCACAGGTACACCTGAAAATGAAAAAAAGGAAGTTAATAGCAAATGAGACAAACTTTAGGAAAAGACTTGATTTTAATCTCACCTCTTGCCCTAGGATCCAGTGCTGTTCTCGGGTTCGTTACGTATAAATCTGGATCCCTTTGATCGCTACACTGATGAAGAGGTTTGGAGATCTCTAGAACTTGCACATCTCAAGACCTTTGTGTCTGACTTGCCTGACAAACTCAACCATGAGTGTTCAGAGGGTGGAGAGAATCTCAGGTACAAACTCTAGATTTCTCACAAATTATTAGCTTGGGTTGTTTTATTCATAAGTTGACTTACACCTGGCCTCTCTAAATACTCTGGCCTTTAGTTTGGGTCAGCGGCAGCTG
Associated Phenotype:
Not determined