Busch Lab

ZMP

btr07p

Ensembl ID:
ENSDARG00000094877
Human Orthologues:
CTD-2611O12.2, CTD-2611O12.3, ERMAP, RFPL1, RFPL2, RFPL3, RFPL4A, RFPL4B
Human Descriptions:
erythroblast membrane-associated protein (Scianna blood group) [Source:HGNC Symbol;Acc:15743]
ret finger protein-like 1 [Source:HGNC Symbol;Acc:9977]
ret finger protein-like 2 [Source:HGNC Symbol;Acc:9979]
ret finger protein-like 3 [Source:HGNC Symbol;Acc:9980]
ret finger protein-like 4A [Source:HGNC Symbol;Acc:16449]
ret finger protein-like 4B [Source:HGNC Symbol;Acc:33264]
Mouse Orthologues:
Ermap, Rfpl4
Mouse Descriptions:
erythroblast membrane-associated protein Gene [Source:MGI Symbol;Acc:MGI:1349816]
ret finger protein-like 4 Gene [Source:MGI Symbol;Acc:MGI:2149590]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa26909 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa26909
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142619 Nonsense 71 517 1 7
Genomic Location (Zv9):
Chromosome 7 (position 17000066)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 15982764
GRCz11 7 16234737
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAGATCAACACTGGACTTGGAGAGTTTGCTCAACGCTTTAAGCAAAGGT[T/G]AAGCCTGCGAATATCTGAGGTCCTCTGTGACATCTGTGATGGGAGAAAGA
Associated Phenotype:
Not determined