Busch Lab

ZMP

B8JLN9_DANRE

Ensembl ID:
ENSDARG00000094873
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JLN9]
Human Orthologue:
KIAA0664
Human Description:
KIAA0664 [Source:HGNC Symbol;Acc:29094]
Mouse Orthologue:
1300001I01Rik
Mouse Description:
RIKEN cDNA 1300001I01 gene Gene [Source:MGI Symbol;Acc:MGI:1921398]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa38662 Nonsense Mutation detected in F1 DNA Not yet available
sa21182 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38662
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133518 Nonsense 142 641 3 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 4693325)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4436356
GRCz11 8 4493062
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAACTCTTGACCCCATGATGGAGCTCCAGGACATCAAAGGCTTCAAAGCT[G/T]GAGTTACTCTTCGTCTAGTGGAAGGTAAACTGGAGGAGCTCTACTTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21182
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133518 Essential Splice Site 296 641 None 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 4683315)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4426346
GRCz11 8 4483052
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAAGCAGTGTGACATCACTTCCTGCCCACGTGGATTTTACCTGAACAGG[T/C]ACGAGAGTTTCATTTCAGAACTGCATTCTGCTCTATTTCTGCATTACAAA
Associated Phenotype:
Not determined