Busch Lab

ZMP

ENSDARG00000094751

Ensembl ID:
ENSDARG00000094751

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa45279 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa45279
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135516 Essential Splice Site 229 257 4 5
Genomic Location (Zv9):
Chromosome 7 (position 30715157)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29107499
GRCz11 7 29378649
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGGAAAAGATGCAGCACTGGCTGTGGTATCTGCCGTCCTTGTCCTGTGG[T/G]AAGAACTTGAAAAAATTGTAACAATCATACAAAAAAGTGTCTTACAAAGC
Associated Phenotype:
Not determined