Busch Lab

ZMP

v2rc1

Ensembl ID:
ENSDARG00000094735
ZFIN ID:
ZDB-GENE-050419-84
Description:
Novel protein similar to vertebrate phermone receptor protein [Source:UniProtKB/TrEMBL;Acc:A3KQM4]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa8580 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4030
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000147225 Nonsense 235 815 3 6
Genomic Location (Zv9):
Chromosome 18 (position 31415809)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33212668
GRCz11 18 33187263
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTAAAATCATCTTMTGCTAGAGTCATACTAAATTTCTCTGTGGACTCTTA[T/A]CTTTATGGTGTTCTAAAAGAATGCAGACGGCAAAATGTCACAMATCTGCA
Long Flanking Sequence:
TCATGTTAGCCTTTTCCCCACACAGAATGTGTTATATACAGGGACATTTTGATTTGCTCTATTCATAGTGTTAATGCTATTAATATTACATTTATGTCTGGTACATGGTGTGACTTTTTATTACATATATTGCACTACTAATCTTATATATGTGCTTTAATTTTACAGGTGAGCTACTTTGCATCATGCTCTTGTCTCAGTAACAAAAGGGAGTTTCCAGCATTCATGCGCACAATGCCAAGTGACCTATTTCAGATTAAAGCTTTAGTAAAACTTGTTTATTATTTTAAGTGGACATGGCTTGGGGTTATCGGTGTGGATACAGACTATGCTCGATTTGCCATCCAGCTGTTCTTGAAAGAGTCAGAAAAATATAATATTTGTCCTGCCTATGTTCACATTTATCCTGTTGCGCTTACTCAAAATACAGTTGAGGAACTTGTTAAGATTTTAAAATCATCTTCTGCTAGAGTCATACTAAATTTCTCTGTGGACTCTTA[T/A]CTTTATGGTGTTCTAAAAGAATGCAGACGGCAAAATGTCACAAATCTGCAGTGGATCGCCAGTGAGGCTTGGGCCACATCAAAAGTCCTCTGGGATGACTTTGGTGATTTGTTAAAGGGAACACTGGGCTTTGCCATACGGAGAGCTGATATTCCGCATCTTGGCAGTTATCTCAGATCAGTAAGCAGTTCTGTTGCTCAGACCTCCCCTTTTTTTACTGAGTTTTGGGAAGAGACTTTCCATTGCAGACTAAATGGATCCTTAAACACTCATGTACATGAAGAAGCATCTTACAACTGGCCAGCCTGCAATGGTAATGAAACTCTGGATGATGTGTATACTCTTTATTCGGATGTGTCACAACTCAGAGTCTCCTACAATGTTTACAAAGCAGTGTATCTCATAGCACATGCACTGCATGACATGAGCACATGTGATCCTGGAAAGGGCCCATTTAAGAATGGTACATGTGGGAGTCTGTATCAAATTTTGCCATGGCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29057
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000147225 Nonsense 420 815 4 6
Genomic Location (Zv9):
Chromosome 18 (position 31416496)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33213355
GRCz11 18 33187950
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTGTACTATATGAAACGAACCAACTTCACAACACTCGGAGAAGAGGTT[C/T]GATTTGATAAGAATGGGGATCCTATTGCATCCTATGATCTGATGAACTGG
Long Flanking Sequence:
AGTTCTGTTGCTCAGACCTCCCCTTTTTTTACTGAGTTTTGGGAAGAGACTTTCCATTGCAGACTAAATGGATCCTTAAACACTCATGTACATGAAGAAGCATCTTACAACTGGCCAGCCTGCAATGGTAATGAAACTCTGGATGATGTGTATACTCTTTATTCGGATGTGTCACAACTCAGAGTCTCCTACAATGTTTACAAAGCAGTGTATCTCATAGCACATGCACTGCATGACATGAGCACATGTGATCCTGGAAAGGGCCCATTTAAGAATGGTACATGTGGGAGTCTGTATCAAATTTTGCCATGGCAGGTGTGTATTGCTTCCCTTTTTTACATTATCTGCCAGTTTTATTCAATAATTATCAGATAGTATAAAAGTATTCAATTATTATAACTGGACTACATTCATATTTTTGTTTTGATTTTCTCCCAAATTCATCTAAGCTTTTGTACTATATGAAACGAACCAACTTCACAACACTCGGAGAAGAGGTT[C/T]GATTTGATAAGAATGGGGATCCTATTGCATCCTATGATCTGATGAACTGGCAACGAGAATCTGATGGCTCCCTTCAGCTTGTCAGGGTGGGAATCTATGATGCCTCCTTCAAAGATGACAAGGACCTAGTGATAGATGAGTCAGTAATTATGTGGCACAGAGGGGACAAGGTGTGTGCCATTCCACGAATCACCAGATATTGCTGGTTATGTTTACTTTTGCTTAAGCTTTACCTAACATTAATGATGGAACTAAAGAGAACTCTATTTAATAATATTAAATGGATATGTGACACTTGAACGCAACATTTTATAAAAAAATCATGTTCTAGTATACACTTTTTTGTACATTTACTACATTTGCGCCATTGATCATTTCATTCATTTACAAACCCAAAATATTTCTCTAATAAAGAGTTATATGCACAATCATATGTTTTACAGTGTAGTGTTTTTCTACTGCTTGTTCCATTGTGGTCATTAGGCGCCAGAATCTTTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8580
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000147225 Nonsense 541 815 6 6
Genomic Location (Zv9):
Chromosome 18 (position 31417268)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33214127
GRCz11 18 33188722
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATGTTCCAAGGACACGTGGCCTAACCAATCCCAAGACCAGTGCATCCCC[A/T]AAACTTTAGAGTTTTTGTCCTTTCAGGAGCCCTTGGGAATAATTCTTTGG
Long Flanking Sequence:
TAATATTAAATGGATATGTGACACTTGAACGCAACATTTTATAAAAAAATCATGTTCTAGTATACACTTTTTTGTACATTTACTACATTTGCGCCATTGATCATTTCATTCATTTACAAACCCAAAATATTTCTCTAATAAAGAGTTATATGCACAATCATATGTTTTACAGTGTAGTGTTTTTCTACTGCTTGTTCCATTGTGGTCATTAGGCGCCAGAATCTTTGTGCAGTAAAAGCTGTCTGCCAGGCTCCAGGAAGGCCAGGCAAAAAGGAAAGCCAGTCTGCTGCTTTGACTGTATATCATGTGCTGAAGGAGAGATCAGTAATCAGACAGGTGTGATTTTCCAGACAGCTTCTCTCTGAATGGCATTCTCAAAAAAGAAAGGAAAATTGCTATTTTATGGTCCAATTTTCTCCAATGTTTCCACAGACTCAATTGATTGCCTGACATGTTCCAAGGACACGTGGCCTAACCAATCCCAAGACCAGTGCATCCCC[A/T]AAACTTTAGAGTTTTTGTCCTTTCAGGAGCCCTTGGGAATAATTCTTTGGGTATTTTCAGCATTGGGGGCCTGTGCAGCATTAGCAGTGCTCTGTGTGTTTGTAATGTATAGGACGACTCCAGTCATACGAGGAAACAATATAGAGTTAAGTTTCCTTCTTCTGTTGTTCCTCTGTGCTTGTTTTTTGATTGGCCTAACATTTTTAGGGAAGCCCACTGACTGGTTGTGCCAAATTCGCTATCCAGCTTTTGGAATCAGCTTTACGCTCTGTATTTCCTGCATCTTGGCAAAAACTGTAGTCGTTTTAATGGCTTTCAGGGCCACCATCCCTGGCAATAATGTCATGAAGTGGTTTGGTCCTGTTAAACAAAGATCAAGTGTTATCCTGTGCACATGTGTGCAAGCACTTATTTGCATCATATGGTTAACAACTAAGCCCCCTCTTGCTTCATACAACAGCAAGTTCCTGAGCGCAACTATAATTGTTGAATGTTCTGTG
Associated Phenotype:
Not determined