Busch Lab

ZMP

acbd7

Ensembl ID:
ENSDARG00000094730
ZFIN ID:
ZDB-GENE-050913-108
Description:
acyl-CoA-binding domain-containing protein 7 [Source:RefSeq peptide;Acc:NP_001122240]
Human Orthologue:
ACBD7
Human Description:
acyl-CoA binding domain containing 7 [Source:HGNC Symbol;Acc:17715]
Mouse Orthologue:
Acbd7
Mouse Description:
acyl-Coenzyme A binding domain containing 7 Gene [Source:MGI Symbol;Acc:MGI:1925495]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa39103 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa42740 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39103
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046209 Essential Splice Site 44 88 None 4
ENSDART00000141708 Essential Splice Site 44 67 None 3
ENSDART00000046209 Essential Splice Site 44 88 None 4
ENSDART00000141708 Essential Splice Site 44 67 None 3
Genomic Location (Zv9):
Chromosome 16 (position 30825627)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28662765
GRCz11 16 28597388
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATTTGTACGGCCTCTACAAACAAGCTGTTGTTGGGGATATTAATATTGG[T/C]AGGAACCGATTAATTTGATTTGTTTGGTTTTGTTTTTAAATCCATATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42740
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046209 Essential Splice Site 44 88 None 4
ENSDART00000141708 Essential Splice Site 44 67 None 3
ENSDART00000046209 Essential Splice Site 44 88 None 4
ENSDART00000141708 Essential Splice Site 44 67 None 3
Genomic Location (Zv9):
Chromosome 16 (position 30825627)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28662765
GRCz11 16 28597388
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATTTGTACGGCCTCTACAAACAAGCTGTTGTTGGGGATATTAATATTGG[T/C]AGGAACCGATTAATTTGATTTGTTTGGTTTTGTTTTTAAATCCATATTAT
Associated Phenotype:
Not determined