Busch Lab

ZMP

LOC100331860

Ensembl ID:
ENSDARG00000094633
Human Orthologue:
GAB3
Human Description:
GRB2-associated binding protein 3 [Source:HGNC Symbol;Acc:17515]
Mouse Orthologue:
Gab3
Mouse Description:
growth factor receptor bound protein 2-associated protein 3 Gene [Source:MGI Symbol;Acc:MGI:2387324]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa44603 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa44603
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000137627 Nonsense 71 85 2 2

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 23714917)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 21427789
GRCz11 5 21931589
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATACAGGGTGGACTATGTGAAGGTAGATGAGAAGAAGACCCAGGCTTTA[C/T]AAAGCACCAAGATGGAGTGGAAGGATGTCCGTCAGTCAAAACCTTAAAGA
Associated Phenotype:
Not determined