Busch Lab

ZMP

si:dkey-222h21.10

Ensembl ID:
ENSDARG00000094608
ZFIN ID:
ZDB-GENE-081031-22
Description:
Novel NACHT domain containing protein [Source:UniProtKB/TrEMBL;Acc:B8JIK0]
Human Orthologue:
NLRP6
Human Description:
NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
Mouse Orthologue:
Nlrp6
Mouse Description:
NLR family, pyrin domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2141990]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa19627 Nonsense Available for shipment Available now
sa1161 Nonsense Confirmed mutation in F2 line Not yet available

Mutation Details

Allele Name:
sa19627
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138007 Nonsense 908 976 7 8
ENSDART00000138467 None None 361 None 5
Genomic Location (Zv9):
Chromosome 1 (position 58923436)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57501384
GRCz11 1 58237066
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGAATCAACAGGAAAGGAGGGAGTGACTCTTGGTTTGGGTACAATGAT[A/T]AATCCTGGAGCATGTACTGCACTGATGACAGATTCACAGTCTGGCATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1161
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138007 Nonsense 951 976 7 8
ENSDART00000138467 None None 361 None 5
Genomic Location (Zv9):
Chromosome 1 (position 58923566)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57501514
GRCz11 1 58237196
KASP Assay ID:
554-1071.1 (used for ordering genotyping assays)
KASP Sequence:
ATCCAAGTTAAAAAGATTAGGAGTGTATGTCGACGTTCCATCCGGCTCTT[T/A]GTCCTTCTACAGTGTCTCTGACACACACACACTCACACTCATACACACAC
Associated Phenotype:
Not determined