Busch Lab

ZMP

cfhl4

Ensembl ID:
ENSDARG00000094496
ZFIN ID:
ZDB-GENE-030131-251
Description:
Novel protein similar to vertebrate complement component (3d/Epstein Barr virus) receptor 2 (CR2) [S
Human Orthologues:
CFH, CFHR1, CFHR2, CFHR3, CFHR4, CFHR5
Human Descriptions:
complement factor H [Source:HGNC Symbol;Acc:4883]
complement factor H-related 1 [Source:HGNC Symbol;Acc:4888]
complement factor H-related 2 [Source:HGNC Symbol;Acc:4890]
complement factor H-related 3 [Source:HGNC Symbol;Acc:16980]
complement factor H-related 4 [Source:HGNC Symbol;Acc:16979]
complement factor H-related 5 [Source:HGNC Symbol;Acc:24668]
Mouse Orthologues:
AL837518.1, Cfh, Cfhr1, Cfhr2, Gm4788
Mouse Descriptions:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8BMW5]
complement component factor h Gene [Source:MGI Symbol;Acc:MGI:88385]
complement factor H-related 1 Gene [Source:MGI Symbol;Acc:MGI:2138169]
complement factor H-related 2 Gene [Source:MGI Symbol;Acc:MGI:3611575]
predicted gene 4788 Gene [Source:MGI Symbol;Acc:MGI:3646434]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29786
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105634 Nonsense 416 480 8 9

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 24282494)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23590250
GRCz11 22 23616814
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCGGCTTCAAGACTTGTAAGAATGGTGAATGGACAGGAAATATTTATTG[T/A]TTAAGTAAGTATGATCAGACTACACCTAAGCATGTGTGCCACAACTTTCA
Associated Phenotype:
Not determined