Busch Lab

ZMP

si:dkey-253d23.8

Ensembl ID:
ENSDARG00000094427
ZFIN ID:
ZDB-GENE-050208-568
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LWP3]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa32377 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4983
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105936 Nonsense 17 237 1 2

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 10016810)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9876978
GRCz11 22 9906660
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACATGAGTGATCCAGGAGCCTGCACAATAAAACAGGAAGATACTGAAGAA[C/T]AAATAGGTTGGTGATTTATTTTATTTTATTTTTTTACCTGATTTTTTTTNNN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32377
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105936 Nonsense 210 237 2 2
Genomic Location (Zv9):
Chromosome 22 (position 10014484)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9874652
GRCz11 22 9904334
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACCTTTCAAATGCCCTGACTGTGGCAAGGCGTTCAAATCATTACAGTG[T/A]CAACGAATACATGAGATGATCCACCGTGGAGAAAAGCCATACAAGTGTGA
Associated Phenotype:
Not determined