Busch Lab

ZMP

si:dkey-20i20.11

Ensembl ID:
ENSDARG00000094343
ZFIN IDs:
ZDB-GENE-060503-58, ZDB-GENE-071004-118
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A3KPV0]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa29694 Nonsense Mutation detected in F1 DNA Not yet available
sa37403 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa29694
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133652 None None 195 None 3
ENSDART00000144785 Nonsense 51 499 2 5
Genomic Location (Zv9):
Chromosome 22 (position 2003228)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2744318
GRCz11 22 2760584
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAGGAGAAACATCAAGAAAAAACCCAATCAGAAACTGAACGTAGTATTT[C/A]AATGAAAGGAACAGCTGTAAATAGTTTGACCTGCACTCAGTGTGGAAAGA
Long Flanking Sequence:
ATTCAGGCTGTTGACATATTGCATCTTGACAAATATGTGAGAAAGTTATTGAAATGTTTATAAATGATGTTCCTCAAAGAAATATAGGGCGACAGAAGACATTCAAGACTGTCCCAGCAAACTCACAAGCAGAGAAACGAGCCCAGATGTCAGCTTTTAGTAGTAGTTGAAGCATTTTGAATGACTCGCACACAATAATCACAGTCATTTTAGAGGAAGTTTAGAGTGAATTTGAAGTTTGAAACTTTGACAGAGCAAATGGAAAGTGATCGGCACCACAAAACCTTTTATTGACACATGCTCATAAACATTTACAGTGTCCACACGTGTGTTTTAGCCAGTAATGATTGCACTGTCAGGACTTTCAAGAGGAACTGTTAAAAACTAACACTTATTCATTTAAGTTTTAGATGTGATTGTGAAGGAGGAGAGTGAAGAACTGAATCAAGATGAGGAGAAACATCAAGAAAAAACCCAATCAGAAACTGAACGTAGTATTT[C/A]AATGAAAGGAACAGCTGTAAATAGTTTGACCTGCACTCAGTGTGGAAAGAGTTTCACCCGCAAAAGCACTCTCAATTATCACATGAGGATCCACACTGGAGAGAAACCTTACAAGTGTTCACACTGCGACAGGAGATTCAGTTGTTCACAAAACCTGAAATCACACACGAGGACTCACACAGGAGAGAAGCCTTACCAGTGTTCATACTGCAGTAGGAGATTCAGACATTCAGGAGTCCTAAAAAAACACTTGAGGACTCACACTGGAGAGAAACCGTATCACTGCACTGCTTGTGGGAAGAGTTTCACAGATCCATCTTCTCTACGAACACACACAAAAAGTTATCACAGTAAGTAGATCAGCTAAAGATCCAGGTTGTACTGTTTGGGATAATTGTGGAGTTTATAGAACGTATTTAATGCTAAATGATATAAGTATGATGTGGTTTCTTCATCATTCCCTCAAGCCATTCAGGCTGTTTACATATTGCATCTTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37403
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133652 None None 195 None 3
ENSDART00000144785 Nonsense 126 499 2 5
Genomic Location (Zv9):
Chromosome 22 (position 2003452)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2744542
GRCz11 22 2760808
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCACACAGGAGAGAAGCCTTACCAGTGTTCATACTGCAGTAGGAGATTC[A/T]GACATTCAGGAGTCCTAAAAAAACACTTGAGGACTCACACTGGAGAGAAA
Long Flanking Sequence:
AGTGAATTTGAAGTTTGAAACTTTGACAGAGCAAATGGAAAGTGATCGGCACCACAAAACCTTTTATTGACACATGCTCATAAACATTTACAGTGTCCACACGTGTGTTTTAGCCAGTAATGATTGCACTGTCAGGACTTTCAAGAGGAACTGTTAAAAACTAACACTTATTCATTTAAGTTTTAGATGTGATTGTGAAGGAGGAGAGTGAAGAACTGAATCAAGATGAGGAGAAACATCAAGAAAAAACCCAATCAGAAACTGAACGTAGTATTTCAATGAAAGGAACAGCTGTAAATAGTTTGACCTGCACTCAGTGTGGAAAGAGTTTCACCCGCAAAAGCACTCTCAATTATCACATGAGGATCCACACTGGAGAGAAACCTTACAAGTGTTCACACTGCGACAGGAGATTCAGTTGTTCACAAAACCTGAAATCACACACGAGGACTCACACAGGAGAGAAGCCTTACCAGTGTTCATACTGCAGTAGGAGATTC[A/T]GACATTCAGGAGTCCTAAAAAAACACTTGAGGACTCACACTGGAGAGAAACCGTATCACTGCACTGCTTGTGGGAAGAGTTTCACAGATCCATCTTCTCTACGAACACACACAAAAAGTTATCACAGTAAGTAGATCAGCTAAAGATCCAGGTTGTACTGTTTGGGATAATTGTGGAGTTTATAGAACGTATTTAATGCTAAATGATATAAGTATGATGTGGTTTCTTCATCATTCCCTCAAGCCATTCAGGCTGTTTACATATTGCATCTTTTCAAATGCAAAAAACAAAGAGGAAGTAGTGCGAGTCGCACTTTCCACACATTTTTGACACAAAGTGAATGGCTCCATAAACAACAATAAAGGACACAGCAGATGCTGTTATTCTGCTTAGCAGAGACACAGGAGATCTTGGGTTCTGTTGTACCTTCAGTGTCAGTGAAAGACTCAAAACTAGACAAATGTGCCCAGATGAGGCTTTTAAAGTAGTTGGAGCATTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4979
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133652 None None 195 None 3
ENSDART00000144785 Nonsense 253 499 4 5
Genomic Location (Zv9):
Chromosome 22 (position 2006564)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2747654
GRCz11 22 2763920
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGCCTTACCAGTGTTCACACTGCGACAAGAGATTCAGTCATTCAAGATA[C/A]CTGAAATCACACGAGAGGACTCACACTGGAGAGAAACCTTACCAGTGTTC
Long Flanking Sequence:
CTGGAGGGCCGCAGCTTTGCACAGTTTTGCTCCAACCCTGATCAAACAGCTGATCCAACTAAAGGTGTTCATGACTCTGTGCAGAGCTGCGGCCGTCCAGGAATTGAGTTTGAAACTTAGAAGAACTGTTCAAATCTAAACTCTTAAAATTAACTTTCAGAAGTGACGGTGAAGGAGGAGAGTGAAGAAATGAATGAAGACGAGGAGAAACATCAGGTCAAAAGTGAAGAAAAAACCCAATCAGAGACTGAAGATATTATTTCAGTGAAAGGAACAGCAGTAAAATATTTCACCTGCACTCAGTGTGGAAAGAGTTTCAGCTTTAAAAGCACTCTCAATTATCACATGAGGATTCACACTGGAGAGAAACCTTACCAGTGTTCATACTGCGACAAGAGATTCAGGTGTTTACAAAGCTTGAAAAGACACACAAGGACTCACACAGGAGAGAAGCCTTACCAGTGTTCACACTGCGACAAGAGATTCAGTCATTCAAGATA[C/A]CTGAAATCACACGAGAGGACTCACACTGGAGAGAAACCTTACCAGTGTTCACACTGCGGCAAGAGATTCAGTGATTCAACGAACCTGAAGACACATCTGAGGACTCACACTGGAGAGAAACCGTATCACTGCACTGCGTGTGGGAAGAGTTTCACATCTTCATCTTCTCTACGAAAACACACAATAAACTGTCACAGTAAGTAGATCAGCTAAAGGTCCAGGTTGTGTTATTTAGGACCGTGACCTTAAACTTGTTTTAGTTTGTGGCCCCCGCCTTGATTTGAAAGTCTAATGTTAGTGCGGCCCGCAGGTTTGACATGTATTGCACTTTACAGTGTTGTGTGCAGATCTGAACGAACCTACCAATCACGGTGGGGTATATGGCTATCGGGGGCGGGACATCAGCTGGGCTTGGTGCAGGCAGAGAAACATTTCTCATCTCATTGAGTGAAAGTTACAGCAGCATCGACATGGAGTGTTTTCCTCCATGCCTGGCTGGC
Associated Phenotype:
Not determined