Busch Lab

ZMP

si:dkey-28d5.9

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa20850 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20850
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134845 Nonsense 82 288 3 4
Genomic Location (Zv9):
Chromosome 7 (position 5052420)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 4742733
GRCz11 7 4880759
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGAATGATGGTGTCTGGATTGGTCTTCAGGGTACAAATGTTTATAATT[G/A]GCATTGGTCTTCAGGTGATCCTGCTCTCTTTCTGAACTGGGCATCTGGAC
Associated Phenotype:
Not determined