Busch Lab

ZMP

si:dkey-58f10.10

Ensembl ID:
ENSDARG00000094284
ZFIN ID:
ZDB-GENE-060526-312
Description:
hypothetical protein LOC100004976 [Source:RefSeq peptide;Acc:NP_001107128]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa727 Nonsense Available for shipment Available now
sa6149 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa727
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000137852 Nonsense 201 204 5 5
ENSDART00000139743 None None 153 None 4
ENSDART00000137852 Nonsense 201 204 5 5
ENSDART00000139743 None None 153 None 4
Genomic Location (Zv9):
Chromosome 5 (position 40286768)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 38086158
GRCz11 5 38686311
KASP Assay ID:
554-3828.1 (used for ordering genotyping assays)
KASP Sequence:
GTTGATACTAACGATATAAATAATTACAGAAATGACACTGTAAAAAAGTA[T/G]AACAGTTTCTGAAAAAGAAAAAAAAGACAGCTGTGGATGCCAGAAGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6149
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000137852 Nonsense 201 204 5 5
ENSDART00000139743 None None 153 None 4
ENSDART00000137852 Nonsense 201 204 5 5
ENSDART00000139743 None None 153 None 4
Genomic Location (Zv9):
Chromosome 5 (position 40286768)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 38086158
GRCz11 5 38686311
KASP Assay ID:
554-3828.1 (used for ordering genotyping assays)
KASP Sequence:
GTTGATACTAACGATATAAATAATTACAGAAATGACACTGTAAAAAAGTA[T/G]AACAGTTTCTGAAAAAGAAAAAAAAGACAGCTGTGGATGCCAGAAGACCA
Associated Phenotype:
Not determined