Busch Lab

ZMP

ENSDARG00000094184

Ensembl ID:
ENSDARG00000094184

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa26873 Nonsense Mutation detected in F1 DNA Not yet available
sa20851 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa26873
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000146878 Nonsense 5 237 1 3
Genomic Location (Zv9):
Chromosome 7 (position 5834661)
KASP Assay ID:
2259-8388.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACTATTTGATTGTCTTAAAGTGAGCACAGGACTGGTGTTTGTCAATCAG[A/T]AGATGAACTGGAGAGATGCTCAGAGTTACTGCAGACAGAATCACATTGAT
Long Flanking Sequence:
CTGTTATGAGAAATGGACAGTGGTTTGTTGAGGCATGTACTACTGACAAGCATTTCTTCATCTGCTACAGTGAGTACAAACCCCTAAAGTAACAAAAATCATTTAACATTCTTTTTTTTATTATTATTCAAATTTAAACATCACAATAATAAACAATACAAAAAGTGTTATGCACTACTAAACAAAGAATTGATATATTTCAAGTCAGACCTACTATGTATTGTTGTGGCAGATACTTATGAAAAACCTGCTATTAAAAGACAAGAGGATAACAGCGTTGAACTATAGTCTTACATTCTGTAGTTTAAAGACAACATAATAATAGTAAATTTTCATAAACCACATAACAATTTAACTGTTCAATAACAAGCTTTTCTTAAACTTTTACTGTCGTTTTAATTACATCCAAAGCATATAGCAGAATGATAAAATAACTGATATAATAATGTTTACTATTTGATTGTCTTAAAGTGAGCACAGGACTGGTGTTTGTCAATCAG[A/T]AGATGAACTGGAGAGATGCTCAGAGTTACTGCAGACAGAATCACATTGATCTGGTCACTGTGAGGAACCAGAATGAGAGTCAACAGCTGGAGAAGTTCATTAATGACAGAAACTCATCTGGATCTGCAGTCTGGATCGGTCTGTTCAGAGACACATGGCAGTGGTCAGATCAGAGCAACTCCTCATTCAGATACTGGAAAACTGGTCAACCTACTAATCAATACAATGTACACCGTGCAGCAGTTGAACAGTTTAGTCAGGGACAATGGAGTATATACATGTACCATATTATAAATAACCAGTTTCCTTTTGTGTGTCATGAAGGTGAGCAGATCCTCCAAACACACTCACTCCATCATCAGCTCCAGATCTCTTAAAGTTGACTCTACATGTCTGACATGACAAATTCCTCCACAGTGTTTGTTCTGCATGTTGTTGTTGATCAGTCTCTCTCTAGTTTCTGCTTTGTTTTGTGTCCAGATAAACTGATTGTGATCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20851
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000146878 Nonsense 62 237 1 3
Genomic Location (Zv9):
Chromosome 7 (position 5834832)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATCTGCAGTCTGGATCGGTCTGTTCAGAGACACATGGCAGTGGTCAGAT[C/T]AGAGCAACTCCTCATTCAGATACTGGAAAACTGGTCAACCTACTAATCAA
Long Flanking Sequence:
GCACTACTAAACAAAGAATTGATATATTTCAAGTCAGACCTACTATGTATTGTTGTGGCAGATACTTATGAAAAACCTGCTATTAAAAGACAAGAGGATAACAGCGTTGAACTATAGTCTTACATTCTGTAGTTTAAAGACAACATAATAATAGTAAATTTTCATAAACCACATAACAATTTAACTGTTCAATAACAAGCTTTTCTTAAACTTTTACTGTCGTTTTAATTACATCCAAAGCATATAGCAGAATGATAAAATAACTGATATAATAATGTTTACTATTTGATTGTCTTAAAGTGAGCACAGGACTGGTGTTTGTCAATCAGAAGATGAACTGGAGAGATGCTCAGAGTTACTGCAGACAGAATCACATTGATCTGGTCACTGTGAGGAACCAGAATGAGAGTCAACAGCTGGAGAAGTTCATTAATGACAGAAACTCATCTGGATCTGCAGTCTGGATCGGTCTGTTCAGAGACACATGGCAGTGGTCAGAT[C/T]AGAGCAACTCCTCATTCAGATACTGGAAAACTGGTCAACCTACTAATCAATACAATGTACACCGTGCAGCAGTTGAACAGTTTAGTCAGGGACAATGGAGTATATACATGTACCATATTATAAATAACCAGTTTCCTTTTGTGTGTCATGAAGGTGAGCAGATCCTCCAAACACACTCACTCCATCATCAGCTCCAGATCTCTTAAAGTTGACTCTACATGTCTGACATGACAAATTCCTCCACAGTGTTTGTTCTGCATGTTGTTGTTGATCAGTCTCTCTCTAGTTTCTGCTTTGTTTTGTGTCCAGATAAACTGATTGTGATCCAGCAGAATCTGTCGTGGTCTGAAGCTCTGAGATACTGCAGACAGCATCATGTGGATCTGGTCTCGGTTCAGTCAGTGGAGATGCAGTATAAGGTGATGAACGTGGTTAAACTGGCGTCTACTGAGGCGGTGTGGTTGGGTTTACGTCACTCCTGTGCTTTGGGCATCTGGTTC
Associated Phenotype:
Not determined