Busch Lab

ZMP

ftr27

Ensembl ID:
ENSDARG00000094131
ZFIN ID:
ZDB-GENE-070912-318
Description:
Novel protein with Zinc finger, C3HC4 type (RING finger) and B-box zinc finger domains [Source:UniPr
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa33023 Nonsense Mutation detected in F1 DNA Not yet available
sa13910 Nonsense Available for shipment Available now
sa14647 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33023
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135584 Nonsense 43 171 2 2
Genomic Location (Zv9):
Chromosome 2 (position 48059662)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48091326
GRCz11 2 47945490
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACCATCCCCTGTGGCCACAGTTATTGTATGAACTGCATTACTGAATACT[G/A]GAATCGACGTGATCTGTCGATTAATAGCTGCCCTCAGTGCAGACAGACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13910
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135584 Nonsense 118 171 2 2
Genomic Location (Zv9):
Chromosome 2 (position 48059888)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48091552
GRCz11 2 47945716
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATGTTTGTAATGGGAGAAAACGCAAAGCTGTYAAATCCKGCYTAGTGTG[T/A]CTCGAATCTTACTGTCAGTGCCATTATGAGTCTCACGAAGAATCTCGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14647
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135584 Nonsense 147 171 2 2
Genomic Location (Zv9):
Chromosome 2 (position 48059973)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48091637
GRCz11 2 47945801
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACGAAGAATCTCGTTCAAAGAAGCGACATAAGRTAACTGATGCCACTAGA[C/T]GAATCCAGGATATAATCTGCTCCAAACAYGACCGACTGCTGGAGGTTTAC
Associated Phenotype:
Not determined