Busch Lab

ZMP

si:dkey-190a9.1

Ensembl ID:
ENSDARG00000094082
ZFIN ID:
ZDB-GENE-081029-2
Human Orthologue:
HIVEP3
Human Description:
human immunodeficiency virus type I enhancer binding protein 3 [Source:HGNC Symbol;Acc:13561]
Mouse Orthologue:
Hivep3
Mouse Description:
human immunodeficiency virus type I enhancer binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:10658

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa23486 Nonsense Available for shipment Available now
sa43247 Nonsense Mutation detected in F1 DNA Not yet available
sa36801 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa23486
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143480 Nonsense 9 1273 1 6

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 14765544)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 15429148
GRCz11 19 15333510
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTTTGATGACCCGCAACCAATTCAGAATCGGCGCCATGGAATGCTAAGA[C/T]GACAGCCTGCAATTGAATTGCCAATTGGCGCTGAATTAACAATGGAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43247
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143480 Nonsense 80 1273 1 6

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 14765331)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 15428935
GRCz11 19 15333297
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAGATATCAAAAACACAAACAACACTGTTGCACAGTTCATATTTCTCAA[C/T]AATCTGAAATTCCTGTTTATCAAGTAGATGAATCCACAAGAACATTTACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29175
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143480 Nonsense 249 1273 1 6

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 14764822)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 15428426
GRCz11 19 15332788
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGATTGTCCCTAAAATGAAGGACACTGAAAAAGTCAGTGAGTTCCAGTG[G/A]CCTCAGAGAAGTCCAACTTTGGCCCAACTTCCAATTGAGAAGTTGCCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36801
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143480 Nonsense 699 1273 1 6

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 14763474)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 15427078
GRCz11 19 15331440
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGGTGCTTTCTAAACTACATAAAGCCAAATCCATCCATACAGAGTGAA[C/T]AACAAAACTCAGTCTATTCTTCATGGTGTACAAGTACCCGCAATCCAAAC
Associated Phenotype:
Not determined