Busch Lab

ZMP

si:dkeyp-11g8.2

Ensembl ID:
ENSDARG00000094010
ZFIN ID:
ZDB-GENE-041015-373
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5RG89]
Human Orthologue:
C1orf26
Human Description:
chromosome 1 open reading frame 26 [Source:HGNC Symbol;Acc:16785]
Mouse Orthologue:
1200016B10Rik
Mouse Description:
RIKEN cDNA 1200016B10 gene Gene [Source:MGI Symbol;Acc:MGI:1914125]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa9859 Essential Splice Site Available for shipment Available now
sa9937 Essential Splice Site Available for shipment Available now
sa10026 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9859
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133593 Essential Splice Site 226 537 6 13
ENSDART00000133593 Essential Splice Site 226 537 6 13
ENSDART00000133593 Essential Splice Site 226 537 6 13
Genomic Location (Zv9):
Chromosome 20 (position 34393227)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34465740
GRCz11 20 34368619
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTGTTGCCAYCCTTCTGTGTRAACRAAGCAGAGAAGCAAGGATCGCAW[G/A]ACAACAGCAATAGCATTGTGGTKGATGAACAAGAKTTGATCGAGTATGTG
Long Flanking Sequence:
ATGGGGAAAATAACTGTATATATACAGTTGAAGTAAGAATTATTAGCCCTCCTGAATTATTAGCGTTGGATTTGAGCCACTTCCATACGTAGTCCTCAACCCAGTGTAGTTTAGATATGCAGAGTCGCATCAAAATTTGTATGATTTTCAGTTCACAATGCAATTTGATAATGGTTTTATAATATTAATATAATATATTAATAAATGATGTGAACAACCAAACAAAATTGAACCAGAGCAAGATTCAAATTTCCTGTCATTGTAATTTAAAACATCACAAAATATACATTGCAGAACAAGATTACATTGCACAGGTACACAATAAAAGCTATAGATTTTTTTTTTTTTTTAAATACTGAAATAAAAGTGCTAATGTTTACAATGTTTACTTGGTCTAAAATTCAACATTTGTCAATAAAACTGAAACATCCTGACTTAAATGTAAAGCCGTTTTGTTGCCACCCTTCTGTGTGAACGAAGCAGAGAAGCAAGGATCGCAA[G/A]ACAACAGCAATAGCATTGTGGTGGATGAACAAGATTTGATCGAGTATGTGTCTTTGCTGGAGTCCTCCCTTCAGGCGGCGCTCTCTGAGGTACTAACGGAGGAGATGAAAGCAGCCTATGGAGACCTGTGGATTGAGGTATTTCTGCACCCAATGATAGTTCATTAATCTTATATGAAGCTTATATTAAAAACTGCTCTGCATTCATCTTAATACATTAGTCATATCTTGAGTAGGATTCAGGGCTCTTATTGTATTTGATGATCTTCTGCAAAGTCCTCTGTGTCCTTGCATTTGTGCATGCAGATAGTGTATGTGAAGCCTCCCTGGAGTCTGGAGGGGCTGCTGAAGTGTTTTAAGAAGCACTGGATCGCCGTCTTCGGACTCATTATCAATAGAAGCCTGCTCAGCTGTGTGGAAATGCTCAGTGACTGTCTCTGTTCAGGTGTGTATAATCCATCAAGTTCACTTAAATGGGTAGTTAATTAATGCTGGTAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9937
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133593 Essential Splice Site 226 537 6 13
ENSDART00000133593 Essential Splice Site 226 537 6 13
ENSDART00000133593 Essential Splice Site 226 537 6 13
Genomic Location (Zv9):
Chromosome 20 (position 34393227)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34465740
GRCz11 20 34368619
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTGTTGCCAYCCTTCTGTGTRAACRAAGCAGAGAAGCAAGGATCGCAW[G/A]ACAACAGCAATAGCATTGTGGTKGATGAACAAGAKTTGATCGAGTATGTG
Long Flanking Sequence:
ATGGGGAAAATAACTGTATATATACAGTTGAAGTAAGAATTATTAGCCCTCCTGAATTATTAGCGTTGGATTTGAGCCACTTCCATACGTAGTCCTCAACCCAGTGTAGTTTAGATATGCAGAGTCGCATCAAAATTTGTATGATTTTCAGTTCACAATGCAATTTGATAATGGTTTTATAATATTAATATAATATATTAATAAATGATGTGAACAACCAAACAAAATTGAACCAGAGCAAGATTCAAATTTCCTGTCATTGTAATTTAAAACATCACAAAATATACATTGCAGAACAAGATTACATTGCACAGGTACACAATAAAAGCTATAGATTTTTTTTTTTTTTTAAATACTGAAATAAAAGTGCTAATGTTTACAATGTTTACTTGGTCTAAAATTCAACATTTGTCAATAAAACTGAAACATCCTGACTTAAATGTAAAGCCGTTTTGTTGCCACCCTTCTGTGTGAACGAAGCAGAGAAGCAAGGATCGCAA[G/A]ACAACAGCAATAGCATTGTGGTGGATGAACAAGATTTGATCGAGTATGTGTCTTTGCTGGAGTCCTCCCTTCAGGCGGCGCTCTCTGAGGTACTAACGGAGGAGATGAAAGCAGCCTATGGAGACCTGTGGATTGAGGTATTTCTGCACCCAATGATAGTTCATTAATCTTATATGAAGCTTATATTAAAAACTGCTCTGCATTCATCTTAATACATTAGTCATATCTTGAGTAGGATTCAGGGCTCTTATTGTATTTGATGATCTTCTGCAAAGTCCTCTGTGTCCTTGCATTTGTGCATGCAGATAGTGTATGTGAAGCCTCCCTGGAGTCTGGAGGGGCTGCTGAAGTGTTTTAAGAAGCACTGGATCGCCGTCTTCGGACTCATTATCAATAGAAGCCTGCTCAGCTGTGTGGAAATGCTCAGTGACTGTCTCTGTTCAGGTGTGTATAATCCATCAAGTTCACTTAAATGGGTAGTTAATTAATGCTGGTAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10026
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133593 Essential Splice Site 226 537 6 13
ENSDART00000133593 Essential Splice Site 226 537 6 13
ENSDART00000133593 Essential Splice Site 226 537 6 13
Genomic Location (Zv9):
Chromosome 20 (position 34393227)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34465740
GRCz11 20 34368619
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTGTTGCCAYCCTTCTGTGTRAACRAAGCAGAGAAGCAAGGATCGCAW[G/A]ACAACAGCAATAGCATTGTGGTKGATGAACAAGAKTTGATCGAGTATGTG
Long Flanking Sequence:
ATGGGGAAAATAACTGTATATATACAGTTGAAGTAAGAATTATTAGCCCTCCTGAATTATTAGCGTTGGATTTGAGCCACTTCCATACGTAGTCCTCAACCCAGTGTAGTTTAGATATGCAGAGTCGCATCAAAATTTGTATGATTTTCAGTTCACAATGCAATTTGATAATGGTTTTATAATATTAATATAATATATTAATAAATGATGTGAACAACCAAACAAAATTGAACCAGAGCAAGATTCAAATTTCCTGTCATTGTAATTTAAAACATCACAAAATATACATTGCAGAACAAGATTACATTGCACAGGTACACAATAAAAGCTATAGATTTTTTTTTTTTTTTAAATACTGAAATAAAAGTGCTAATGTTTACAATGTTTACTTGGTCTAAAATTCAACATTTGTCAATAAAACTGAAACATCCTGACTTAAATGTAAAGCCGTTTTGTTGCCACCCTTCTGTGTGAACGAAGCAGAGAAGCAAGGATCGCAA[G/A]ACAACAGCAATAGCATTGTGGTGGATGAACAAGATTTGATCGAGTATGTGTCTTTGCTGGAGTCCTCCCTTCAGGCGGCGCTCTCTGAGGTACTAACGGAGGAGATGAAAGCAGCCTATGGAGACCTGTGGATTGAGGTATTTCTGCACCCAATGATAGTTCATTAATCTTATATGAAGCTTATATTAAAAACTGCTCTGCATTCATCTTAATACATTAGTCATATCTTGAGTAGGATTCAGGGCTCTTATTGTATTTGATGATCTTCTGCAAAGTCCTCTGTGTCCTTGCATTTGTGCATGCAGATAGTGTATGTGAAGCCTCCCTGGAGTCTGGAGGGGCTGCTGAAGTGTTTTAAGAAGCACTGGATCGCCGTCTTCGGACTCATTATCAATAGAAGCCTGCTCAGCTGTGTGGAAATGCTCAGTGACTGTCTCTGTTCAGGTGTGTATAATCCATCAAGTTCACTTAAATGGGTAGTTAATTAATGCTGGTAATTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1654
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133593 Nonsense 322 537 8 13
Genomic Location (Zv9):
Chromosome 20 (position 34389825)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34462338
GRCz11 20 34365217
KASP Assay ID:
554-1594.1 (used for ordering genotyping assays)
KASP Sequence:
TGTCTAATCTCAATTTTGTTATGTTCTATCTGTTCTTAGACAGGTCTGTA[G/T]AGCACACATCTRTTCTTAGTGCTGTGAGTTTGGCTAAAGAGCTGCTGTCT
Long Flanking Sequence:
GAAGATGCTAAAAACTCATCTTTTTAAGACTGCATTTTTAGATTTTTGATTATTCTGTGGTTTTATTTTAGAGCTTTTGTATTTGTATTTTATGGCATGTTTGATTTCTCTGTTGTTGTAGCTCTTTGGGTCTTAGAAAAGTGCATTATAAATAATGTATTATTATTATAATTATTATTTTTTTTATTAATATGCAGTCTGAACTCGCCATTATTTAACCCATTTTAACTTGGAATTAATTTGCCTTAATTTTTATAATTATGCAGTTCATTTACTCACTTTAAGTACAGTCAACTAATCACTTTAAAGCATCCTATTTATCTGTCTGTCTGTTATTCTGTTGTACTTTGTTTATTCTTCTGTCTCTCCATCATTTAATCAATCAATCAATCCATGTCTTGTCCAAGTTTTATTTTTTCATCAATGGATCTATTGGTGCGTCTAACTTTCTGTCTAATCTCAATTTTGTTATGTTCTATCTGTTCTTAGACAGGTCTGTA[G/T]AGCACACATCTATTCTTAGTGCTGTGAGTTTGGCTAAAGAGCTGCTGTCTGCACTGTCTGGCAGATCTCAGTACAGCGGTCACGTAGCCCATGCTCTTTCTACACTTCATACACTACAGCAAAGATTACAGGTAAGCTTCATTACAACATGACTGTGAGTAATTGTTACATTCTGATTACTCATCATGATTTCTCTCTGTGTGTCAGTCTCCAAAAGCTCTATTAGAAAGCGGCGAAGCTGATAATGAGGACTCTCTGATGGCGGAAATAGAGGATGATGTAGCTTTACCTCCTTCCACATCCCATCAGGAGGTTTGGGCGTTGTTTGAGAGCATCTGGAACAACGTGTGTCAGATAAGGTGAGAGAGGCAGTTACAAATGATGAAAGTGTATTTCTCAACATGCAATTTAGTGACAGTAAGATGTCTTTTTGCACTGTAGTAAAACATTTATTTGTGTTTTAAATAAATACTGTTCTTCTGAACTTTCTATTCAATACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7940
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133593 Nonsense 419 537 10 13
Genomic Location (Zv9):
Chromosome 20 (position 34388918)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34461431
GRCz11 20 34364310
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACTTCAATGCATTACAGAGTCTTTTTTTTNCTCTCTTTTCAGTTCATCTT[T/A]GTTCTCAGCACTCCRCTATACTCCAGGAACCACTGAGCCCAGYCTGCGAT
Long Flanking Sequence:
ATTTAGTGACAGTAAGATGTCTTTTTGCACTGTAGTAAAACATTTATTTGTGTTTTAAATAAATACTGTTCTTCTGAACTTTCTATTCAATACAAATCAGGGGAAAATCACTCAAAACCTTTTTGTTTGATGATATGAATAATATTAGCAACACATTAGCATATTAGAATAATGTTTGAAGTATCCCATCACTGAAGTGTAATGATGTCGAAAATTCAGATTTGCTATCATAAAAATAAATGACATTTTAAAAAGTTATTTTAATGTCATTTGTTTTACAACATTACTGTGTTTTTAATTGAATTTTAAAGCAATCATGACTTCCGTCAATAACCCCAAAAATACAGTATTTTTATATTAAATGCAGGTTACATGCTCTGCTTAAATATGAACCTGATAATAAATCTTGATCAGGTTCTGTTTGGAATATACTGACTCTTATCAAAAAGAAACTTCAATGCATTACAGAGTCTTTTTTTTCTCTCTTTTCAGTTCATCTT[T/A]GTTCTCAGCACTCCACTATACTCCAGGAACCACTGAGCCCAGTCTGCGATCTACCTCACCCCCACCTCAGGAAGCTCTGTCATGCCTACAAAGACTCTCCACTGCACTAAAACAGCTACTGGAGGCTCTTCAGAGGTATGCGCATGCTAGTAAAAACAAGCACACATCTCTGCAGTATTAGCAGAATCTATTAACATTCCAGTCATGTGCTTGCTGAAAGAACTCGGTCAATTTCTTTCCTTAGTCATCTGGGCATGTAGAGGACAGAAGTAGGCTTGTGTCGCACGTGGAATGGGGGTTACGTCTTAATCTTCATAATCATCAGACTCGGTGCATACTCATTATCAAGCCCTCCCCGATCCTGTCGGTTTGTGTCTTCGTGACTCACTTCCGGTGCTCAGCATTTCTCAGCCTTCATGGCTCATAGCACAAGGCGTACAGATTTGTCTGTGACATGGCAATTTTTCCTCTAAATTAGGATTTCTGCATCGCGCAAGCAC
Associated Phenotype:
Not determined