Busch Lab

ZMP

si:ch73-138e16.3

Ensembl ID:
ENSDARG00000093895
ZFIN ID:
ZDB-GENE-070705-202
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5WWL0]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa43749 Nonsense Mutation detected in F1 DNA Not yet available
sa12104 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3196
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132104 Nonsense 194 243 3 3
ENSDART00000138163 Nonsense 164 426 1 2
Genomic Location (Zv9):
Chromosome 22 (position 2460243)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 1273091
GRCz11 22 1289989
KASP Assay ID:
554-3426.1 (used for ordering genotyping assays)
KASP Sequence:
AYGTGTGCTGTCAGTGTGAGAAGACTTTTATCACAGCTGGTTTGTTGAAA[C/T]AGCATCAGAAGATCCACACTGGTGTGAGAGAGTTTGTGTGCTTTGAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43749
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132104 None None 243 None 3
ENSDART00000138163 Nonsense 343 426 2 2

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 2464872)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 1277720
GRCz11 22 1294618
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTCACACCTGCAGAACCATCTGAGAGTTCACACTAAAGAGAAACCGTA[T/A]TCATGCTGTGAGTGTGGGAAGAGCTTTGCAACGCAGTCCAGTTTACGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12104
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132104 None None 243 None 3
ENSDART00000138163 Nonsense 402 426 2 2

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 2465048)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 1277896
GRCz11 22 1294794
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTGAAGAAGCACCAGAGGATTCACACTGAGGAGAAACCRTACAAGTGTT[C/A]ATACTGCGACAAGAGCTTCAGGCGGACAGGAGACCTGAAAGTGCATGAGA
Associated Phenotype:
Not determined